Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW177997.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW177997.1, 688 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|6444034|gb|AW177997.1|AW177997 IL3-HT0060-200899-009-C09 HT0060 Homo sapiens cDNA, mRNA sequence
>ENSG00000140443

1-24  (15627-15650)   87% <-
25-390  (266962-267327)   99% ->
391-674  (272599-272882)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 CTCCTGACCTTGTGATTCTCCCGC         CTCGGCCTCCCAAAGTG
        |||||||||||||||| | ||| |<<<...<<<|||||||||||||||||
  15627 CTCCTGACCTTGTGATCCGCCCACCTC...CGCCTCGGCCTCCCAAAGTG

     50     .    :    .    :    .    :    .    :    .    :
     42 CTGGGGTTATAGCCTTGAGCCACCACATCTGGCCGAGACCAGCTATCTTC
        ||||| ||||||||||||||||||||||||||||||||||||||||||||
 266979 CTGGGATTATAGCCTTGAGCCACCACATCTGGCCGAGACCAGCTATCTTC

    100     .    :    .    :    .    :    .    :    .    :
     92 TTGATTAAAGGTACTGAGAGCTATTATTTTTCCTTACAAGCATGTATAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267029 TTGATTAAAGGTACTGAGAGCTATTATTTTTCCTTACAAGCATGTATAAC

    150     .    :    .    :    .    :    .    :    .    :
    142 GGCTTTCATTCCCACTCTTGTTTTGGCTTTTCTTTTCCGAGAAGACAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267079 GGCTTTCATTCCCACTCTTGTTTTGGCTTTTCTTTTCCGAGAAGACAAAA

    200     .    :    .    :    .    :    .    :    .    :
    192 TCCCCATCAGGAAGTATGCCGACGGCACCATCGACATTGAGGAGGTCACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267129 TCCCCATCAGGAAGTATGCCGACGGCACCATCGACATTGAGGAGGTCACA

    250     .    :    .    :    .    :    .    :    .    :
    242 GAGAACCCCAAGACTGAGGTGTGTGGTGGGGAGAAAGGGCCTTGCTGCGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267179 GAGAACCCCAAGACTGAGGTGTGTGGTGGGGAGAAAGGGCCTTGCTGCGC

    300     .    :    .    :    .    :    .    :    .    :
    292 CTGCCCCAAAACTGAAGCCGAGAAGCAGGCCGAGAAGGAGGAGGCTGAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267229 CTGCCCCAAAACTGAAGCCGAGAAGCAGGCCGAGAAGGAGGAGGCTGAAT

    350     .    :    .    :    .    :    .    :    .    :
    342 ACCGCAAAGTCTTTGAGAATTTCCTGCACAACTCCATCTTCGTGCCCAG 
        |||||||||||||||||||||||||||||||||||||||||||||||||>
 267279 ACCGCAAAGTCTTTGAGAATTTCCTGCACAACTCCATCTTCGTGCCCAGG

    400     .    :    .    :    .    :    .    :    .    :
    391         ACCTGAAAGGAAGCGGAGAGATGTCATGCAAGTGGCCAACAC
        >>...>>>||||||||||||||||||||||||||||||||||||||||||
 267329 TA...CAGACCTGAAAGGAAGCGGAGAGATGTCATGCAAGTGGCCAACAC

    450     .    :    .    :    .    :    .    :    .    :
    433 CACCATGTCCAGCCGAAGCAGGAACACCACGGCCGCAGACACCTACAACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272641 CACCATGTCCAGCCGAAGCAGGAACACCACGGCCGCAGACACCTACAACA

    500     .    :    .    :    .    :    .    :    .    :
    483 TCACCGGCCCGGAAGAGCTGGAGACAGAGTACCCTTTCTTTGAGAGCAGA
        |||||| |||||||||||||||||||||||||||||||||||||||||||
 272691 TCACCGACCCGGAAGAGCTGGAGACAGAGTACCCTTTCTTTGAGAGCAGA

    550     .    :    .    :    .    :    .    :    .    :
    533 GTGGATAACAAGGAGAGAACTGTCATTTCTAACCTTCGGCCTTTCACATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272741 GTGGATAACAAGGAGAGAACTGTCATTTCTAACCTTCGGCCTTTCACATT

    600     .    :    .    :    .    :    .    :    .    :
    583 GTACCGCATCGATATCCACAGCTGCAACCACGAGGCTGAGAAGCTGGGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272791 GTACCGCATCGATATCCACAGCTGCAACCACGAGGCTGAGAAGCTGGGCT

    650     .    :    .    :    .    :    .    :
    633 GCAGCGCCTCCAACTTCGTCTTTGCAAGGACTATGCCCGCAG
        ||||||||||||||||||||||||||||||||||||||||||
 272841 GCAGCGCCTCCAACTTCGTCTTTGCAAGGACTATGCCCGCAG

END