Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW178050.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW178050.1, 550 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|6444087|gb|AW178050.1|AW178050 IL3-HT0060-260899-012-F05 HT0060 Homo sapiens cDNA, mRNA sequence
>ENSG00000140443

(complement)

1-146  (33612-33758)   98% <-
147-283  (34271-34407)   100% <-
284-550  (35852-36118)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 ATAGAAGAACACAGGATCTGTCCACGACCCATTCCCATAGAGAGATGTGG
        ||||||||||||||||||||||||||||||||||||| ||||||||||||
  33612 ATAGAAGAACACAGGATCTGTCCACGACCCATTCCCAGAGAGAGATGTGG

     50     .    :    .    :    .    :    .    :    .    :
     51 CCTGAATCCGGGCTGTGTAGTTCCCCGGGTTTAGCCGGTT AGCTTGGCC
        ||||||||||||||||||||||||||||||||||||||||-|||||||||
  33662 CCTGAATCCGGGCTGTGTAGTTCCCCGGGTTTAGCCGGTTTAGCTTGGCC

    100     .    :    .    :    .    :    .    :    .    :
    100 CCTCCATACTTCCTGTATTCCTGTCTGGACACACATTCTCGCTGATC   
        |||||||||||||||||||||||||||||||||||||||||||||||<<<
  33712 CCTCCATACTTCCTGTATTCCTGTCTGGACACACATTCTCGCTGATCCTG

    150     .    :    .    :    .    :    .    :    .    :
    147       CTCAACTTGTGATCCGTATTTTATTTCATACATTAGAATCAATC
        ...<<<||||||||||||||||||||||||||||||||||||||||||||
  33762 ...TACCTCAACTTGTGATCCGTATTTTATTTCATACATTAGAATCAATC

    200     .    :    .    :    .    :    .    :    .    :
    191 CATTGGGATTCTCAGGTTCCGGCCACTTTAAAAAGATGGAGTTTTCAGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  34315 CATTGGGATTCTCAGGTTCCGGCCACTTTAAAAAGATGGAGTTTTCAGGC

    250     .    :    .    :    .    :    .    :    .    :
    241 CTTGGCTCCCAGGTCACTGGCCCAGGAATGTCATCTGCTCCTT       
        |||||||||||||||||||||||||||||||||||||||||||<<<...<
  34365 CTTGGCTCCCAGGTCACTGGCCCAGGAATGTCATCTGCTCCTTCTG...T

    300     .    :    .    :    .    :    .    :    .    :
    284   CTGCGGGCATAGTCCTTGCAAAGACGAAGTTGGAGGCGCTGCAGCCCA
        <<||||||||||||||||||||||||||||||||||||||||||||||||
  35850 ACCTGCGGGCATAGTCCTTGCAAAGACGAAGTTGGAGGCGCTGCAGCCCA

    350     .    :    .    :    .    :    .    :    .    :
    332 GCTTCTCAGCCTCGTGGTTGCAGCTGTGGATATCGATGCGGTACAATGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  35900 GCTTCTCAGCCTCGTGGTTGCAGCTGTGGATATCGATGCGGTACAATGTG

    400     .    :    .    :    .    :    .    :    .    :
    382 AAAGGCCGAAGGTTAGAAATGACAGTTCTCTCCTTGTTATCCACTCTGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  35950 AAAGGCCGAAGGTTAGAAATGACAGTTCTCTCCTTGTTATCCACTCTGCT

    450     .    :    .    :    .    :    .    :    .    :
    432 CTCAAAGAAAGGGTACTCTGTCTCCAGCTCTTCCGGGTCGGTGATGTTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  36000 CTCAAAGAAAGGGTACTCTGTCTCCAGCTCTTCCGGGTCGGTGATGTTGT

    500     .    :    .    :    .    :    .    :    .    :
    482 AGGTGTCTGCGGCCGTGGTGTTCCTGCTTCGGCTGGACATGGTGGTGTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  36050 AGGTGTCTGCGGCCGTGGTGTTCCTGCTTCGGCTGGACATGGTGGTGTTG

    550     .    :    .
    532 GCCACTTGCATGACATCTC
        |||||||||||||||||||
  36100 GCCACTTGCATGACATCTC

END