Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW182487.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW182487.1, 714 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6450947|gb|AW182487.1|AW182487 xj42g01.x1 Soares_NFL_T_GBC_S1 Homo sapiens cDNA clone IMAGE:2659920 3' similar to gb:M28668 CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR (HUMAN);, mRNA sequence
>ENSG00000001626

(complement)

3-714  (1-714)   99%

      0     .    :    .    :    .    :    .    :    .    :
      3 ACACAAATGTATGGATTTTATTGACAAGTGATATTTTCTTACAGTAATAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 ACACAAATGTATGGATTTTATTGACAAGTGATATTTTCTTACAGTAATAA

     50     .    :    .    :    .    :    .    :    .    :
     53 ATATAATGCAGTCTTCTTAAGAGTCAGTTTGGAGTTGAGAAGGCAGTGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 ATATAATGCAGTCTTCTTAAGAGTCAGTTTGGAGTTGAGAAGGCAGTGTA

    100     .    :    .    :    .    :    .    :    .    :
    103 CCCTTGATGGAAACAGTCAGACTGGTGGTACCATCTTCTTCAGAACTGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 CCCTTGATGGAAACAGTCAGACTGGTGGTACCATCTTCTTCAGAACTGCA

    150     .    :    .    :    .    :    .    :    .    :
    153 TCTAAGAGGCTGTGCTGGCTGGGAATCATACAGCTGTGGGCAACAACTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 TCTAAGAGGCTGTGCTGGCTGGGAATCATACAGCTGTGGGCAACAACTGC

    200     .    :    .    :    .    :    .    :    .    :
    203 ATCAGCCCCAAGGCTTCCCTCCAGACCAAAAGGTGATTCATGGCCCCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 ATCAGCCCCAAGGCTTCCCTCCAGACCAAAAGGTGATTCATGGCCCCTGG

    250     .    :    .    :    .    :    .    :    .    :
    253 TTAATATCACCCTAGGTTCTCCCCTGTCCCAGTTTTAACATAATATTTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    251 TTAATATCACCCTAGGTTCTCCCCTGTCCCAGTTTTAACATAATATTTCA

    300     .    :    .    :    .    :    .    :    .    :
    303 TAGAAATACTAGTGCCATAAAAAGTCAATATTTCAAATATAAAAATTATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    301 TAGAAATACTAGTGCCATAAAAAGTCAATATTTCAAATATAAAAATTATT

    350     .    :    .    :    .    :    .    :    .    :
    353 TTATACAAATGTAATTCATAATCATTCTTTTAAAATACAGCATTGTTATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    351 TTATACAAATGTAATTCATAATCATTCTTTTAAAATACAGCATTGTTATA

    400     .    :    .    :    .    :    .    :    .    :
    403 TATGTTTGAAACATTATTAAAATAAATATTTCCTAGAGAAAAAATTTTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    401 TATGTTTGAAACATTATTAAAATAAATATTTCCTAGAGAAAAAATTTTGC

    450     .    :    .    :    .    :    .    :    .    :
    453 TTCACAAAATTATAAAACAGAAGCATATAAAACTAATTCATGATTGGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    451 TTCACAAAATTATAAAACAGAAGCATATAAAACTAATTCATGATTGGTGC

    500     .    :    .    :    .    :    .    :    .    :
    503 TTCTTCAGTGTGTCTCTCATTCTCTCTTAGTGTAGACAGCATGAAGTACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    501 TTCTTCAGTGTGTCTCTCATTCTCTCTTAGTGTAGACAGCATGAAGTACA

    550     .    :    .    :    .    :    .    :    .    :
    553 TACATCTAGCCTGAAAACATACCACCATCAACCTATACATCTAAATGCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    551 TACATCTAGCCTGAAAACATACCACCATCAACCTATACATCTAAATGCTT

    600     .    :    .    :    .    :    .    :    .    :
    603 GGACTTCATGTGTGTCTACCCACAGTGCCCATGGCCTATCTACTTACACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    601 GGACTTCATGTGTGTCTACCCACAGTGCCCATGGCCTATCTACTTACACA

    650     .    :    .    :    .    :    .    :    .    :
    653 CCCTCTACCTGGAGCTTCTGTGGAAAGAAGG CTGTCCTGTGACA TTTG
        |||||||||||||||||||||||||||||||-|||||||||||||-||||
    651 CCCTCTACCTGGAGCTTCTGTGGAAAGAAGGGCTGTCCTGTGACAATTTG

    700     .    :
    701 CACTAACATACTTT
        ||||||||||||||
    701 CACTAACATACTTT

END