Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW204378.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW204378.1, 319 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|6503850|gb|AW204378.1|AW204378 UI-H-BI1-adv-b-10-0-UI.s1 NCI_CGAP_Sub3 Homo sapiens cDNA clone IMAGE:2717923 3', mRNA sequence
>ENSG00000017427

12-319  (2-309)   100%

      0     .    :    .    :    .    :    .    :    .    :
     12 TTTTCTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      2 TTTTCTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCC

     50     .    :    .    :    .    :    .    :    .    :
     62 AGGACCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     52 AGGACCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATG

    100     .    :    .    :    .    :    .    :    .    :
    112 TTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    102 TTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCA

    150     .    :    .    :    .    :    .    :    .    :
    162 AACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    152 AACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGA

    200     .    :    .    :    .    :    .    :    .    :
    212 GCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    202 GCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTT

    250     .    :    .    :    .    :    .    :    .    :
    262 CCTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    252 CCTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTC

    300     .
    312 AAATGTAC
        ||||||||
    302 AAATGTAC

END