Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW297827.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW297827.1, 507 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6704452|gb|AW297827.1|AW297827 UI-H-BW0-aiy-h-11-0-UI.s1 NCI_CGAP_Sub6 Homo sapiens cDNA clone IMAGE:2731244 3', mRNA sequence
>ENSG00000001626

1-497  (54266-54762)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 TTTTTTTTTTTTTTGTTGAAATTATCTAACTTTCCATTTTTCTTTTAGAC
        ||| | |||| |||||||||||||||||||||||||||||||||||||||
  54266 TTTGTATTTTGTTTGTTGAAATTATCTAACTTTCCATTTTTCTTTTAGAC

     50     .    :    .    :    .    :    .    :    .    :
     51 TTTAAAGCTGTCAAGCCGTGTTCTAGATAAAATAAGTATTGGACAACTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54316 TTTAAAGCTGTCAAGCCGTGTTCTAGATAAAATAAGTATTGGACAACTTG

    100     .    :    .    :    .    :    .    :    .    :
    101 TTAGTCTCCTTTCCAACAACCTGAACAAATTTGATGAAGTATGTACCTAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54366 TTAGTCTCCTTTCCAACAACCTGAACAAATTTGATGAAGTATGTACCTAT

    150     .    :    .    :    .    :    .    :    .    :
    151 TGATTTAATCTTTTAGGCACTATTGTTATAAATTATACAACTGGAAAGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54416 TGATTTAATCTTTTAGGCACTATTGTTATAAATTATACAACTGGAAAGGC

    200     .    :    .    :    .    :    .    :    .    :
    201 GGAGTTTTCCTGGGTCAGATAATAGTAATTAGTGGTTAAGTCTTGCTCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54466 GGAGTTTTCCTGGGTCAGATAATAGTAATTAGTGGTTAAGTCTTGCTCAG

    250     .    :    .    :    .    :    .    :    .    :
    251 CTCTAGCTTCCCTATTCTGGAAACTAAGAAAGGTCAATTGTATAGCAGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54516 CTCTAGCTTCCCTATTCTGGAAACTAAGAAAGGTCAATTGTATAGCAGAG

    300     .    :    .    :    .    :    .    :    .    :
    301 CACCATTCTGGGGTCTGGTAGAACCACCCAACTCAAAGGCACCTTAGCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54566 CACCATTCTGGGGTCTGGTAGAACCACCCAACTCAAAGGCACCTTAGCCT

    350     .    :    .    :    .    :    .    :    .    :
    351 GTTGTTAATAAGATTTTTCAAAACTTAATTCTTATCAGACCTTGCTTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54616 GTTGTTAATAAGATTTTTCAAAACTTAATTCTTATCAGACCTTGCTTCTT

    400     .    :    .    :    .    :    .    :    .    :
    401 TTTAAAACTTTAAATCTGTTATGTACTTTGGCCAGATATGATACCTGAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54666 TTTAAAACTTTAAATCTGTTATGTACTTTGGCCAGATATGATACCTGAGC

    450     .    :    .    :    .    :    .    :    .
    451 AATTCTTGTTCTGGGTTGTCTTATGTGAAAAATAAATTCAAGGTCCT
        |||||||||||||||||||||||||||||||||||||||||||||||
  54716 AATTCTTGTTCTGGGTTGTCTTATGTGAAAAATAAATTCAAGGTCCT

END