Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW351685.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW351685.1, 243 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6849398|gb|AW351685.1|AW351685 RC2-CT0163-110999-002-B09 CT0163 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-243  (187629-187871)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 ATGATGTTTAGAAACACAACTATATTGTTTGCTAAGCATTCCAACTATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187629 ATGATGTTTAGAAACACAACTATATTGTTTGCTAAGCATTCCAACTATCT

     50     .    :    .    :    .    :    .    :    .    :
     51 CATTTCCAAGCAAGTATTAGAATACCACAGGAACCACAAGACTGCACATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187679 CATTTCCAAGCAAGTATTAGAATACCACAGGAACCACAAGACTGCACATC

    100     .    :    .    :    .    :    .    :    .    :
    101 AAAATATGCCCCATTCAACATCTAGTGAGCAGTCAGGAAAGAGAACTTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187729 AAAATATGCCCCATTCAACATCTAGTGAGCAGTCAGGAAAGAGAACTTCC

    150     .    :    .    :    .    :    .    :    .    :
    151 AGATCCTGGAAATCAGGGTTAGTATTGTCCAGGTCTACCAAAAATCTCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187779 AGATCCTGGAAATCAGGGTTAGTATTGTCCAGGTCTACCAAAAATCTCAA

    200     .    :    .    :    .    :    .    :
    201 TATTTCAGATAATCACAATACATCCCTTACCTGGGAAAGGGCT
        |||||||||||||||||||||||||||||||||||||||||||
 187829 TATTTCAGATAATCACAATACATCCCTTACCTGGGAAAGGGCT

END