Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW351695.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW351695.1, 367 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6849408|gb|AW351695.1|AW351695 RC2-CT0163-200999-001-C01 CT0163 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

(complement)

1-367  (822-1189)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 TTATAACAGCCC TTCCCAGGTAAGGGATGTATTGTGATTATCTGAAATA
        ||||||||||||-|||||||||||||||||||||||||||||||||||||
    822 TTATAACAGCCCTTTCCCAGGTAAGGGATGTATTGTGATTATCTGAAATA

     50     .    :    .    :    .    :    .    :    .    :
     50 TTGAGATTTTTGGTAGACCTGGACAATACTAACCCTGATTTCCAGGATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    872 TTGAGATTTTTGGTAGACCTGGACAATACTAACCCTGATTTCCAGGATCT

    100     .    :    .    :    .    :    .    :    .    :
    100 GGAAGTTCTCTTTCCTGACTGCTCACTACATGTTGAATGGGGCATATTTT
        |||||||||||||||||||||||||||| |||||||||||||||||||||
    922 GGAAGTTCTCTTTCCTGACTGCTCACTAGATGTTGAATGGGGCATATTTT

    150     .    :    .    :    .    :    .    :    .    :
    150 GATGTGCAGTCTTGTGGTTCCTGTGGTATTCTAATACTTGCTTGGAAATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    972 GATGTGCAGTCTTGTGGTTCCTGTGGTATTCTAATACTTGCTTGGAAATG

    200     .    :    .    :    .    :    .    :    .    :
    200 AGATAGTTGGAATGCTTAGCAAACAATATAGTTGTGTTTCTAAACATCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1022 AGATAGTTGGAATGCTTAGCAAACAATATAGTTGTGTTTCTAAACATCAT

    250     .    :    .    :    .    :    .    :    .    :
    250 GGGGAGAGGAGAGAAAAAGGAATACAAGCTTATATAAACCGCTGAAGTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1072 GGGGAGAGGAGAGAAAAAGGAATACAAGCTTATATAAACCGCTGAAGTTT

    300     .    :    .    :    .    :    .    :    .    :
    300 CCAGTTATCATTACTTAATCATAACCCTAAGAAGTATGATTTCAGGTCTT
        ||||||||||||||||||||||||||||||||||||||||||||| ||||
   1122 CCAGTTATCATTACTTAATCATAACCCTAAGAAGTATGATTTCAGTTCTT

    350     .    :    .
    350 CTCCAACACTACAAATTA
        ||||||||||||||||||
   1172 CTCCAACACTACAAATTA

END