Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW375342.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW375342.1, 671 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6879996|gb|AW375342.1|AW375342 RC2-CT0163-220999-001-E04 CT0163 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

10-671  (187049-187714)   97%

      0     .    :    .    :    .    :    .    :    .    :
     10 TCTGTCCC A CGGAACTCAAGCAAGTGCAAGTCTAAGCCCCAGATCGCT
        ||| ||||-|-||||||||||||||||||||||||||||||||||| |||
 187049 TCTTTCCCCACCGGAACTCAAGCAAGTGCAAGTCTAAGCCCCAGATTGCT

     50     .    :    .    :    .    :    .    :    .    :
     58 GCTCTGAAAGAGGAGACAGAAGAAGAGGTGCAAGATACAAGGCTTTAGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187099 GCTCTGAAAGAGGAGACAGAAGAAGAGGTGCAAGATACAAGGCTTTAGAG

    100     .    :    .    :    .    :    .    :    .    :
    108 AGCAGCATAAATGT GACATGGGACATT GCTCATGGAATTGGAGCTCGT
        ||||||||||||||-|||||||||||||-|||||||||||||||||||||
 187149 AGCAGCATAAATGTTGACATGGGACATTTGCTCATGGAATTGGAGCTCGT

    150     .    :    .    :    .    :    .    :    .    :
    156 GGGACAGTCACCTCATGGAATTGGAGCTCGTGGAACAGTTACCTCTGCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187199 GGGACAGTCACCTCATGGAATTGGAGCTCGTGGAACAGTTACCTCTGCCT

    200     .    :    .    :    .    :    .    :    .    :
    206 CAGAAAACAAGGATGAATTAAG TTTTTTTTAAAAAAGAAACATTTGGTA
        ||||||||||||||||||||||-|||||||||||||||||||||||||||
 187249 CAGAAAACAAGGATGAATTAAGTTTTTTTTTAAAAAAGAAACATTTGGTA

    250     .    :    .    :    .    :    .    :    .    :
    255 AGGGGAATTGAGGACACTGATATGGGTCTTGATAAATGGCTTCCTGGCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187299 AGGGGAATTGAGGACACTGATATGGGTCTTGATAAATGGCTTCCTGGCAA

    300     .    :    .    :    .    :    .    :    .    :
    305 TAGTCAAATAGTGTGAAAGGTACTTCAAATCCTTGAAGATTTACCACTTG
        ||||||||| ||||||||||||||||||||||||||||||||||||||||
 187349 TAGTCAAATTGTGTGAAAGGTACTTCAAATCCTTGAAGATTTACCACTTG

    350     .    :    .    :    .    :    .    :    .    :
    355 TGTTTTGCAAGCCAGATTTTCCTGAAAACCCTTGCCATGTGCTAGTAATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187399 TGTTTTGCAAGCCAGATTTTCCTGAAAACCCTTGCCATGTGCTAGTAATT

    400     .    :    .    :    .    :    .    :    .    :
    405 GGAAAGGCAGCTCTAAATGTCAATCAGCCTAGTTGATCAGCTTATGGTCT
        ||||||||||||||||||||||||||||||||||||||||||||| ||||
 187449 GGAAAGGCAGCTCTAAATGTCAATCAGCCTAGTTGATCAGCTTATTGTCT

    450     .    :    .    :    .    :    .    :    .    :
    455 AGTGAAACTCGTTAATTTGTAGTGTAGGAGAAGAACTGAAATCTTACTTC
        ||||||||||||||||||||||||| ||||||||||||||||| ||||||
 187499 AGTGAAACTCGTTAATTTGTAGTGTTGGAGAAGAACTGAAATCATACTTC

    500     .    :    .    :    .    :    .    :    .    :
    505 TTAGGGTTATGATTAAGTAATGATAACTGGAAACTTCAGCGGTTTATATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187549 TTAGGGTTATGATTAAGTAATGATAACTGGAAACTTCAGCGGTTTATATA

    550     .    :    .    :    .    :    .    :    .    :
    555 AGCTTGTATTCCTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187599 AGCTTGTATTCCTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAAC

    600     .    :    .    :    .    :    .    :    .    :
    605 TATATGGTTTGCTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAG
        ||||| ||||||||||||||||||||||||||||||||||||||||||||
 187649 TATATTGTTTGCTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAG

    650     .    :    .
    655 AATAC ACAGGGAACACA
        |||||-|||||-|||-||
 187699 AATACCACAGG AAC CA

END