Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW375369.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW375369.1, 259 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6880023|gb|AW375369.1|AW375369 RC2-CT0163-230999-003-D04 CT0163 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

(complement)

1-259  (813-1071)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 TGTGAAAGATTATAACAGCCCTTTCCCAGGTAAGGGATGTATTGTGATTG
        ||||||||||||||||||||||||||||||||||||||||||||||||| 
    813 TGTGAAAGATTATAACAGCCCTTTCCCAGGTAAGGGATGTATTGTGATTA

     50     .    :    .    :    .    :    .    :    .    :
     51 TCTGAAATATTGAGATTTTGGGTAGACCTGGACAATACTAACCCTGATTT
        ||||||||||||||||||| ||||||||||||||||||||||||||||||
    863 TCTGAAATATTGAGATTTTTGGTAGACCTGGACAATACTAACCCTGATTT

    100     .    :    .    :    .    :    .    :    .    :
    101 CCAGGATCTGGAAGTTCTCTTTCCTGACTGCTCACTAGATGTTGAATGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    913 CCAGGATCTGGAAGTTCTCTTTCCTGACTGCTCACTAGATGTTGAATGGG

    150     .    :    .    :    .    :    .    :    .    :
    151 GCATATTTTGATGTGCAGTCTTGTGGTTCCTGTGGTATTCTAATACTTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    963 GCATATTTTGATGTGCAGTCTTGTGGTTCCTGTGGTATTCTAATACTTGC

    200     .    :    .    :    .    :    .    :    .    :
    201 TTGGAAATGAGATAGTTGGAATGCTTAGCAAACAATATAGTTGTGTTTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1013 TTGGAAATGAGATAGTTGGAATGCTTAGCAAACAATATAGTTGTGTTTCT

    250     .
    251 AAACATCAT
        |||||||||
   1063 AAACATCAT

END