Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW377223.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW377223.1, 496 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6881886|gb|AW377223.1|AW377223 MR2-CT0222-201099-001-g03 CT0222 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

(complement)

1-496  (689-1187)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 AGCGAC ATTTGCACTAACATACTTT CCAGCTAAACTCTAGTTCAAAGG
         | |||-|||||||||||||||||||-|||||||||||||||||||||||
    689 TGTGACAATTTGCACTAACATACTTTTCCAGCTAAACTCTAGTTCAAAGG

     50     .    :    .    :    .    :    .    :    .    :
     49 TCTGTGAGCTTGTCACTTTCTGGAGTTGGGAAAAGGCATATCAACTTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    739 TCTGTGAGCTTGTCACTTTCTGGAGTTGGGAAAAGGCATATCAACTTCTT

    100     .    :    .    :    .    :    .    :    .    :
     99 CATCAAGGGAA CATCCTGTCCCCTGTGAAAGATTATAACAGCCCTTTCC
        |||||||||||-||||||||||||||||||||||||||||||||||||||
    789 CATCAAGGGAACCATCCTGTCCCCTGTGAAAGATTATAACAGCCCTTTCC

    150     .    :    .    :    .    :    .    :    .    :
    148 CAGGTAAGGGATGTATTGTGATTATCTGAAATATTGAGATTTTGGGTAGA
        ||||||||||||||||||||||||||||||||||||||||||| ||||||
    839 CAGGTAAGGGATGTATTGTGATTATCTGAAATATTGAGATTTTTGGTAGA

    200     .    :    .    :    .    :    .    :    .    :
    198 CCTGGACAATACTAACCCTGATTTCCAGGATCTGGAAGTTCTCTTTCCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    889 CCTGGACAATACTAACCCTGATTTCCAGGATCTGGAAGTTCTCTTTCCTG

    250     .    :    .    :    .    :    .    :    .    :
    248 ACTGCTCACTAGATGTTGAATGGGGCATATTTTGATGTGCAGTCTTGTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    939 ACTGCTCACTAGATGTTGAATGGGGCATATTTTGATGTGCAGTCTTGTGG

    300     .    :    .    :    .    :    .    :    .    :
    298 TTCCTGTGCTATTCTAATACTTGCTTGGAAATGAGATAGTTGGAATGCTT
        |||||||| |||||||||||||||||||||||||||||||||||||||||
    989 TTCCTGTGGTATTCTAATACTTGCTTGGAAATGAGATAGTTGGAATGCTT

    350     .    :    .    :    .    :    .    :    .    :
    348 AGAAAACAATATAGTTGTGTTTCTAAACATCATGGGGAGAGGAGAGAAAA
        || |||||||||||||||||||||||||||||||||||||||||||||||
   1039 AGCAAACAATATAGTTGTGTTTCTAAACATCATGGGGAGAGGAGAGAAAA

    400     .    :    .    :    .    :    .    :    .    :
    398 AGGAATACAAGCTTATATAAACCGCTGAAGTTTCCAGTTATCATTACTTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1089 AGGAATACAAGCTTATATAAACCGCTGAAGTTTCCAGTTATCATTACTTA

    450     .    :    .    :    .    :    .    :    .
    448 ATCATAACCCTTAGAAGTATGATTTCAGGTCTTCTCCAACACTACAAAT
        ||||||||||| |||||||||||||||| ||||||||||||||||||||
   1139 ATCATAACCCTAAGAAGTATGATTTCAGTTCTTCTCCAACACTACAAAT

END