Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW377240.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW377240.1, 578 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6881903|gb|AW377240.1|AW377240 MR2-CT0222-211099-002-f01 CT0222 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-578  (187167-187747)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 A GCGACATTTGCTCAT GAATTGGAGCTCGTGGGACAGTCACCTCATGG
        |-| |||||||||||||-||||||||||||||||||||||||||||||||
 187167 ATGGGACATTTGCTCATGGAATTGGAGCTCGTGGGACAGTCACCTCATGG

     50     .    :    .    :    .    :    .    :    .    :
     49 AATTGGAGCTCGTGGAACAAGTTACCTCTGCCTCAGAAAACAAGGATGAA
        ||||||||||||||||||-|||||||||||||||||||||||||||||||
 187217 AATTGGAGCTCGTGGAAC AGTTACCTCTGCCTCAGAAAACAAGGATGAA

    100     .    :    .    :    .    :    .    :    .    :
     99 TTAAGTTTTTTTTTAAAAAAGAAACATTGGGTAAGGGGAATTGAGGACAC
        |||||||||||||||||||||||||||| |||||||||||||||||||||
 187266 TTAAGTTTTTTTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAGGACAC

    150     .    :    .    :    .    :    .    :    .    :
    149 TGATATGGGTCTTGATAAATGGCTTCCTGGCAATAGTCAAATTGTGTGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187316 TGATATGGGTCTTGATAAATGGCTTCCTGGCAATAGTCAAATTGTGTGAA

    200     .    :    .    :    .    :    .    :    .    :
    199 AGGTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTCGCAAGCCAGAT
        |||||||||||||||||||||||||||||||||||||| |||||||||||
 187366 AGGTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTTGCAAGCCAGAT

    250     .    :    .    :    .    :    .    :    .    :
    249 TTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187416 TTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAA

    300     .    :    .    :    .    :    .    :    .    :
    299 TGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187466 TGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATT

    350     .    :    .    :    .    :    .    :    .    :
    349 TGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187516 TGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTAAG

    400     .    :    .    :    .    :    .    :    .    :
    399 TAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187566 TAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTT

    450     .    :    .    :    .    :    .    :    .    :
    449 CTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATTGTTTGCTAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187616 CTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATTGTTTGCTAAGC

    500     .    :    .    :    .    :    .    :    .    :
    499 ATTCCAACTATCTCATTTCCAAGCAAGTTTTTGAATACCACCAGGA CCA
        |||||||||||||||||||||||||||| || ||||||||-|||||-|||
 187666 ATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATACCA CAGGAACCA

    550     .    :    .    :    .    :
    548 CAAGACTGCGC TCAAAATATGCCCCAT CAAC
        ||||||||| |-||||||||||||||||-||||
 187715 CAAGACTGCACATCAAAATATGCCCCATTCAAC

END