Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW377246.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW377246.1, 426 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6881909|gb|AW377246.1|AW377246 MR2-CT0222-211099-002-b02 CT0222 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-426  (187167-187591)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 A GGCGCACATTTGCTCATTGGATTGGAGCTCGTGGGACAGTCACCTCAT
        |-||-|-|||||||||||| | ||||||||||||||||||||||||||||
 187167 ATGG G ACATTTGCTCATGGAATTGGAGCTCGTGGGACAGTCACCTCAT

     50     .    :    .    :    .    :    .    :    .    :
     50 GGAATTGGAGCTCGTGGAACAGTTACCTCTGCCTCAGAAAACAAGGATGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187215 GGAATTGGAGCTCGTGGAACAGTTACCTCTGCCTCAGAAAACAAGGATGA

    100     .    :    .    :    .    :    .    :    .    :
    100 ATTAAGTTTTTTTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAGGACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187265 ATTAAGTTTTTTTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAGGACA

    150     .    :    .    :    .    :    .    :    .    :
    150 CTGATATGGGTCTTGATAAATGGCTTCCTGGCAATAGTCAAATTGTGTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187315 CTGATATGGGTCTTGATAAATGGCTTCCTGGCAATAGTCAAATTGTGTGA

    200     .    :    .    :    .    :    .    :    .    :
    200 AAGGTACTTCAAATCCTTGAAGATTTACCACTTATGTTTTGCAAGCCAGA
        ||||||||||||||||||||||||||||||||| ||||||||||||||||
 187365 AAGGTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTTGCAAGCCAGA

    250     .    :    .    :    .    :    .    :    .    :
    250 TTTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187415 TTTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAA

    300     .    :    .    :    .    :    .    :    .    :
    300 ATGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAATTCGTTAAT
        ||||||||||||||||||||||||||||||||||||||||| ||||||||
 187465 ATGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAAT

    350     .    :    .    :    .    :    .    :    .    :
    350 TTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187515 TTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTAA

    400     .    :    .    :    .
    400 GTAGTGATAACTGGAAACTTCAGCGGT
        ||| |||||||||||||||||||||||
 187565 GTAATGATAACTGGAAACTTCAGCGGT

END