Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW377252.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW377252.1, 580 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6881915|gb|AW377252.1|AW377252 MR2-CT0222-211099-002-e11 CT0222 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

(complement)

1-580  (689-1269)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 AGCGAC ATTTGCACTAACATTC TTTCCAGCTAAACTCTAGTTCAAAGG
         | |||-|||||||||||||| |-||||||||||||||||||||||||||
    689 TGTGACAATTTGCACTAACATACTTTTCCAGCTAAACTCTAGTTCAAAGG

     50     .    :    .    :    .    :    .    :    .    :
     49 TCTGTGAGCTTGTCACTTTCTGGAGTTGGGAAAAGGCATATCAACTTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    739 TCTGTGAGCTTGTCACTTTCTGGAGTTGGGAAAAGGCATATCAACTTCTT

    100     .    :    .    :    .    :    .    :    .    :
     99 CATCAAGGGAACCCATCCTGTCCCCTGTGAAAGATTATAACAGCCCTTTC
        |||||||||||||-||||||||||||||||||||||||||||||||||||
    789 CATCAAGGGAACC ATCCTGTCCCCTGTGAAAGATTATAACAGCCCTTTC

    150     .    :    .    :    .    :    .    :    .    :
    149 CCAGGTAAGGGATGTATTGTGATTATCTGAAATATTGAGATTTTGGGTAG
        |||||||||||||||||||||||||||||||||||||||||||| |||||
    838 CCAGGTAAGGGATGTATTGTGATTATCTGAAATATTGAGATTTTTGGTAG

    200     .    :    .    :    .    :    .    :    .    :
    199 ACCTGGACAATACTAACCCTGATTTCCAGGATCTGGAAGTTCTCTTTCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    888 ACCTGGACAATACTAACCCTGATTTCCAGGATCTGGAAGTTCTCTTTCCT

    250     .    :    .    :    .    :    .    :    .    :
    249 GACTGCTCACTAGATGTTGAATGGGGCATATTTTGATGTGCAGTCTTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    938 GACTGCTCACTAGATGTTGAATGGGGCATATTTTGATGTGCAGTCTTGTG

    300     .    :    .    :    .    :    .    :    .    :
    299 GTCCCTGTGGTATTCTAATACTTGCTTGGAAATGAGATAGTTGGAATGCT
        || |||||||||||||||||||||||||||||||||||||||||||||||
    988 GTTCCTGTGGTATTCTAATACTTGCTTGGAAATGAGATAGTTGGAATGCT

    350     .    :    .    :    .    :    .    :    .    :
    349 TAGCAAACAATATAGTTGTGTTTCTAAACATCATGGGGAGAGGAGAGAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1038 TAGCAAACAATATAGTTGTGTTTCTAAACATCATGGGGAGAGGAGAGAAA

    400     .    :    .    :    .    :    .    :    .    :
    399 AAGGAATACAAGCTTTTTTTAACCGCTGAAGTTTCCAGTTATCATTACTT
        ||||||||||||||| | | ||||||||||||||||||||||||||||||
   1088 AAGGAATACAAGCTTATATAAACCGCTGAAGTTTCCAGTTATCATTACTT

    450     .    :    .    :    .    :    .    :    .    :
    449 AATCATAACCCTTAGAAGTATGATTTCAGTTCTTCTCCAACACTACAAAT
        |||||||||||| |||||||||||||||||||||||||||||||||||||
   1138 AATCATAACCCTAAGAAGTATGATTTCAGTTCTTCTCCAACACTACAAAT

    500     .    :    .    :    .    :    .    :    .    :
    499 TAACGAGTTTCCCTAGACAATAAGCTGATCAACTAGGCTGATTGACATTT
        ||||||||||| ||||||||||||||||||||||||||||||||||||||
   1188 TAACGAGTTTCACTAGACAATAAGCTGATCAACTAGGCTGATTGACATTT

    550     .    :    .    :    .    :
    549 AGAGCTGTCTTTCCAATTACTAGCACATGGCA
        ||||||| ||||||||||||||||||||||||
   1238 AGAGCTGCCTTTCCAATTACTAGCACATGGCA

END