Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW377255.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW377255.1, 577 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6881918|gb|AW377255.1|AW377255 MR2-CT0222-211099-002-f12 CT0222 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-577  (187171-187745)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 NACATTTTGCTCATGG ATTGGAGCTCGTGGGACAGTCACCTCATGGAAT
         ||||||-||||||||-|||||||||||||||||||||||||||||||||
 187171 GACATTT GCTCATGGAATTGGAGCTCGTGGGACAGTCACCTCATGGAAT

     50     .    :    .    :    .    :    .    :    .    :
     50 TGGAGCTCGTGGAAAAGGTTACCTCTGCCTCAGAAAACAAGGATGAATTA
        |||||||||||||| |-|||||||||||||||||||||||||||||||||
 187220 TGGAGCTCGTGGAACA GTTACCTCTGCCTCAGAAAACAAGGATGAATTA

    100     .    :    .    :    .    :    .    :    .    :
    100 AGTATTTTTTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAGGACACTG
        |||-||||||||||||||||||||||||||||||||||||||||||||||
 187269 AGT TTTTTTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAGGACACTG

    150     .    :    .    :    .    :    .    :    .    :
    150 ATATGGGTCTTGATAAATGGCTTCCTGGCAATAGTCAAATTGTGTGAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187318 ATATGGGTCTTGATAAATGGCTTCCTGGCAATAGTCAAATTGTGTGAAAG

    200     .    :    .    :    .    :    .    :    .    :
    200 GTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTCGCAAGCCAGATTT
        |||||||||||||||||||||||||||||||||||| |||||||||||||
 187368 GTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTTGCAAGCCAGATTT

    250     .    :    .    :    .    :    .    :    .    :
    250 TCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187418 TCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAATG

    300     .    :    .    :    .    :    .    :    .    :
    300 TCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATTGG
        |||||||||||||||||||||||||||||||||||||||||||||||| |
 187468 TCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATTTG

    350     .    :    .    :    .    :    .    :    .    :
    350 TAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTAAGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187518 TAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTAAGTA

    400     .    :    .    :    .    :    .    :    .    :
    400 ATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187568 ATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTTCT

    450     .    :    .    :    .    :    .    :    .    :
    450 CTCCTCTCCCCATGATGTTTAGAAACACAACTATTTTGTTTGCTAAGCAT
        |||||||||||||||||||||||||||||||||| |||||||||||||||
 187618 CTCCTCTCCCCATGATGTTTAGAAACACAACTATATTGTTTGCTAAGCAT

    500     .    :    .    :    .    :    .    :    .    :
    500 TCCAACTATCTCATTTCCAAGCAAGTTTTTGAATACCACAGTAACCACAA
        |||||||||||||||||||||||||| || ||||||||||| ||||||||
 187668 TCCAACTATCTCATTTCCAAGCAAGTATTAGAATACCACAGGAACCACAA

    550     .    :    .    :    .
    550 GACTGTGCATCAAAATATGCCCCATTCA
        |||||  |||||||||||||||||||||
 187718 GACTGCACATCAAAATATGCCCCATTCA

END