Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW377256.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW377256.1, 253 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6881919|gb|AW377256.1|AW377256 MR2-CT0222-261099-003-a02 CT0222 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

(complement)

1-253  (740-988)   94%

      0     .    :    .    :    .    :    .    :    .    :
      1 C GTGAGCTTGTCACTTTCTGGAGTTGGGAAAAGGCATATCAACTTCTTC
        |-||||||||||||||||||||||||||||||||||||||||||||||||
    740 CTGTGAGCTTGTCACTTTCTGGAGTTGGGAAAAGGCATATCAACTTCTTC

     50     .    :    .    :    .    :    .    :    .    :
     50 ATCAAGGGAGGCATCCTGTCCCCTGTGAAAGATTATAACAGCCCTTTCCC
        |||||||||  |||||||||||||||||||||||||||||||||||||||
    790 ATCAAGGGAACCATCCTGTCCCCTGTGAAAGATTATAACAGCCCTTTCCC

    100     .    :    .    :    .    :    .    :    .    :
    100 AGGTAAGGGATGTATTGTGATTATCTTGAAAATATTGGGGATTTTTGGTA
        ||||||||||||||||||||||||||-|-|||||||| |-||||||||||
    840 AGGTAAGGGATGTATTGTGATTATCT G AAATATTGAG ATTTTTGGTA

    150     .    :    .    :    .    :    .    :    .    :
    150 GACCTGGACAATACTAACCCTGATTTCCAGGATCTGGAAGTTCTCTTTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    887 GACCTGGACAATACTAACCCTGATTTCCAGGATCTGGAAGTTCTCTTTCC

    200     .    :    .    :    .    :    .    :    .    :
    200 TGACTGGGCACTAGATGTTGAATGGGGCATATTTTGGTGTTGCAGGCTTG
        ||||||  |||||||||||||||||||||||||||| ||-||||| ||||
    937 TGACTGCTCACTAGATGTTGAATGGGGCATATTTTGATG TGCAGTCTTG

    250 
    250 TGGG
        |||-
    986 TGG 

END