Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW377266.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW377266.1, 657 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6881929|gb|AW377266.1|AW377266 MR2-CT0222-261099-003-f01 CT0222 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-657  (187162-187819)   96%

      0     .    :    .    :    .    :    .    :    .    :
      1 CAGACCAGCGACATTTGCTCATGGAATTGGAGCTCGTGGGACAGTCACCT
          |||  | |||||||||||||||||||||||||||||||||||||||||
 187162 TTGACATGGGACATTTGCTCATGGAATTGGAGCTCGTGGGACAGTCACCT

     50     .    :    .    :    .    :    .    :    .    :
     51 CATG AATTGGAGCTCGTGGAACAGGTTACCTCTGCCTCAGAAAACAAGG
        ||||-||||||||||||||||||||-||||||||||||||||||||||||
 187212 CATGGAATTGGAGCTCGTGGAACAG TTACCTCTGCCTCAGAAAACAAGG

    100     .    :    .    :    .    :    .    :    .    :
    100 ATGAATTAAGTTTTGTGTTAAAAAAGAAACATTTGGTAAGGGGAATTGGG
        |||||||||||||| | ||||||||||||||||||||||||||||||| |
 187261 ATGAATTAAGTTTTTTTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAG

    150     .    :    .    :    .    :    .    :    .    :
    150 GGACACTGATATGGGTCTTGATAAATGGCTTCCTGGCAATAGTCAAATTG
        |-||||||||||||||||||||||||||||||||||||||||||||||||
 187311 G ACACTGATATGGGTCTTGATAAATGGCTTCCTGGCAATAGTCAAATTG

    200     .    :    .    :    .    :    .    :    .    :
    200 TGTGAAAGGTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTTGCAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187360 TGTGAAAGGTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTTGCAAG

    250     .    :    .    :    .    :    .    :    .    :
    250 CCAGATTTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187410 CCAGATTTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGC

    300     .    :    .    :    .    :    .    :    .    :
    300 TCTAAATGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187460 TCTAAATGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCG

    350     .    :    .    :    .    :    .    :    .    :
    350 TTAATTTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187510 TTAATTTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATG

    400     .    :    .    :    .    :    .    :    .    :
    400 ATTAAGTAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187560 ATTAAGTAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTC

    450     .    :    .    :    .    :    .    :    .    :
    450 CTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATTGTTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187610 CTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATTGTTTG

    500     .    :    .    :    .    :    .    :    .    :
    500 CTAAGCATTCCAACTATCTCATTTCCAAGCAAGTTTTTGAATACCACAGG
        |||||||||||||||||||||||||||||||||| || ||||||||||||
 187660 CTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATACCACAGG

    550     .    :    .    :    .    :    .    :    .    :
    550 AACCACAAGACTGCGCATCAAAAAATAGCCCATTCAACATCTAGTGAGCA
        |||||||||||||| |||||||| ||  ||||||||||||||||||||||
 187710 AACCACAAGACTGCACATCAAAATATGCCCCATTCAACATCTAGTGAGCA

    600     .    :    .    :    .    :    .    :    .    :
    600 GTCAGGAAAGAGAACT CCAGATCCTGGAAATCAGGGT AGTATTGTCCA
        ||||||||||||||||-|||||||||||||||||||||-|||||||||||
 187760 GTCAGGAAAGAGAACTTCCAGATCCTGGAAATCAGGGTTAGTATTGTCCA

    650     .    :
    648 G TCTCCCCAA
        |-||| ||-||
 187810 GGTCTACC AA

END