Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW377268.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW377268.1, 634 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6881931|gb|AW377268.1|AW377268 MR2-CT0222-261099-003-f09 CT0222 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

5-634  (187164-187795)   98%

      0     .    :    .    :    .    :    .    :    .    :
      5 GACCAGCGACATTTGCTCATGGAATTGGAGCTCGTGGGACAGTCAC TCA
        |||  | |||||||||||||||||||||||||||||||||||||||-|||
 187164 GACATGGGACATTTGCTCATGGAATTGGAGCTCGTGGGACAGTCACCTCA

     50     .    :    .    :    .    :    .    :    .    :
     54 TGGAATTGGAGCTCGTGGAAAAGTTACCTCTGCCTCAGAAAACAAGGATG
        |||||||||||||||||||| |||||||||||||||||||||||||||||
 187214 TGGAATTGGAGCTCGTGGAACAGTTACCTCTGCCTCAGAAAACAAGGATG

    100     .    :    .    :    .    :    .    :    .    :
    104 AATTAAG TGTTGTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAGGAC
        |||||||-| || |||||||||||||||||||||||||||||||||||||
 187264 AATTAAGTTTTTTTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAGGAC

    150     .    :    .    :    .    :    .    :    .    :
    153 ACTGATATGGGTCTTGATAAATGGCTTCCTGGCAATAGTCAAATTGTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187314 ACTGATATGGGTCTTGATAAATGGCTTCCTGGCAATAGTCAAATTGTGTG

    200     .    :    .    :    .    :    .    :    .    :
    203 AAAGGTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTTGCAAGCCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187364 AAAGGTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTTGCAAGCCAG

    250     .    :    .    :    .    :    .    :    .    :
    253 ATTTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187414 ATTTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTA

    300     .    :    .    :    .    :    .    :    .    :
    303 AATGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187464 AATGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAA

    350     .    :    .    :    .    :    .    :    .    :
    353 TTTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187514 TTTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTA

    400     .    :    .    :    .    :    .    :    .    :
    403 AGTAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187564 AGTAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTT

    450     .    :    .    :    .    :    .    :    .    :
    453 TTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATTGTTTGCTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187614 TTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATTGTTTGCTAA

    500     .    :    .    :    .    :    .    :    .    :
    503 GCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATACCACAGGGACC
        |||||||||||||||||||||||||||||||||||||||||||||| |||
 187664 GCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATACCACAGGAACC

    550     .    :    .    :    .    :    .    :    .    :
    553 ACAAGACTGCGCATCATAATATGGCCCATTCAACATCTAGTGAGCAGTCA
        |||||||||| ||||| |||||| ||||||||||||||||||||||||||
 187714 ACAAGACTGCACATCAAAATATGCCCCATTCAACATCTAGTGAGCAGTCA

    600     .    :    .    :    .    :
    603 GGAAAGAGAACTTCCAGATCCTGGAAATCAGG
        ||||||||||||||||||||||||||||||||
 187764 GGAAAGAGAACTTCCAGATCCTGGAAATCAGG

END