Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW377285.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW377285.1, 629 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6881948|gb|AW377285.1|AW377285 MR2-CT0222-261099-003-h07 CT0222 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

(complement)

1-629  (691-1318)   96%

      0     .    :    .    :    .    :    .    :    .    :
      1 CGGCA TTTGGCTACTAACATACTTT CCAGCTAAACTCTAGTACAAAGG
         | ||-|||-||-|||||||||||||-|||||||||||||||| ||||||
    691 TGACAATTT GC ACTAACATACTTTTCCAGCTAAACTCTAGTTCAAAGG

     50     .    :    .    :    .    :    .    :    .    :
     49  GTCTGAGCTTGCTCACTTGTCTGGAGTTGGGAAAAGGCATATCAACTTC
        - | ||||||||-||||||-||||||||||||||||||||||||||||||
    739 TCTGTGAGCTTG TCACTT TCTGGAGTTGGGAAAAGGCATATCAACTTC

    100     .    :    .    :    .    :    .    :    .    :
     98 TTCATCAAGGGAACCATCCTGTCCCCTGTGAAAGATTATAACAGCCCTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    787 TTCATCAAGGGAACCATCCTGTCCCCTGTGAAAGATTATAACAGCCCTTT

    150     .    :    .    :    .    :    .    :    .    :
    148 CCCAGGTAAGGGATGTATTGTGATTATCTGAAATATTGAGATTTTGGGTA
        ||||||||||||||||||||||||||||||||||||||||||||| ||||
    837 CCCAGGTAAGGGATGTATTGTGATTATCTGAAATATTGAGATTTTTGGTA

    200     .    :    .    :    .    :    .    :    .    :
    198 GACCTGGACAATACTAACCCTGATTTCCAGGATCTGGAAGTTCTCTTTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    887 GACCTGGACAATACTAACCCTGATTTCCAGGATCTGGAAGTTCTCTTTCC

    250     .    :    .    :    .    :    .    :    .    :
    248 TGACTGCTCACTAGATGTTGAATGGGGCATATTTTGATGTGCAGTCTTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    937 TGACTGCTCACTAGATGTTGAATGGGGCATATTTTGATGTGCAGTCTTGT

    300     .    :    .    :    .    :    .    :    .    :
    298 GGTTCCTGTGGTATTCTAATACTTGCTTGGAAATGAGATAGTTGGAATGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    987 GGTTCCTGTGGTATTCTAATACTTGCTTGGAAATGAGATAGTTGGAATGC

    350     .    :    .    :    .    :    .    :    .    :
    348 TTAGCAAACAATATAGTTGTGTCTCTAAACATCATGGGGAGAGGAGAGAA
        |||||||||||||||||||||| |||||||||||||||||||||||||||
   1037 TTAGCAAACAATATAGTTGTGTTTCTAAACATCATGGGGAGAGGAGAGAA

    400     .    :    .    :    .    :    .    :    .    :
    398 AAAGGAATACAAGCTTATATAAACCGCTGAAGTTTCCAGTTATCATTACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1087 AAAGGAATACAAGCTTATATAAACCGCTGAAGTTTCCAGTTATCATTACT

    450     .    :    .    :    .    :    .    :    .    :
    448 TAATCATAACCCTAAGAAGTATGATTTCAGTTCTTCTCCAACACTACAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1137 TAATCATAACCCTAAGAAGTATGATTTCAGTTCTTCTCCAACACTACAAA

    500     .    :    .    :    .    :    .    :    .    :
    498 TTAACGAGTTTCACTAGACAATAAGCTGATCAACTAGGCTGATTGACATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1187 TTAACGAGTTTCACTAGACAATAAGCTGATCAACTAGGCTGATTGACATT

    550     .    :    .    :    .    :    .    :    .    :
    548 TAGAGCTGCCTTTCCAATTACTAGCACATGGCAAGNGTTTTCAGGAAAAT
        ||||||||||||||||||||||||||||||||||| ||||||||||||||
   1237 TAGAGCTGCCTTTCCAATTACTAGCACATGGCAAGGGTTTTCAGGAAAAT

    600     .    :    .    :    .    :
    598 CTGGGTTGCGAAACACAAGTGGTGCATCTTCA
        |||| |||| |||||||||||||  |||||||
   1287 CTGGCTTGCAAAACACAAGTGGTAAATCTTCA

END