Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW377304.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW377304.1, 676 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6881967|gb|AW377304.1|AW377304 MR2-CT0222-261099-004-g05 CT0222 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-676  (187175-187852)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 TTTGCTCATGGAATTGGAGCTCGTAGAACAG CACCTCATGGAA TGGAG
        |||||||||||||||||||||||| | ||||-||||||||||||-|||||
 187175 TTTGCTCATGGAATTGGAGCTCGTGGGACAGTCACCTCATGGAATTGGAG

     50     .    :    .    :    .    :    .    :    .    :
     49 CTCGTGGAACAGTTACCTCTGCCTCAGAAAACAAGGATGAATTAAG TTT
        ||||||||||||||||||||||||||||||||||||||||||||||-|||
 187225 CTCGTGGAACAGTTACCTCTGCCTCAGAAAACAAGGATGAATTAAGTTTT

    100     .    :    .    :    .    :    .    :    .    :
     98 TTTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAGGACACTGATATGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187275 TTTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAGGACACTGATATGGG

    150     .    :    .    :    .    :    .    :    .    :
    148 TCTTGATAAATGGCTTCCTGGCAATAGTCAAATTGTGTGAAAGGTACTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187325 TCTTGATAAATGGCTTCCTGGCAATAGTCAAATTGTGTGAAAGGTACTTC

    200     .    :    .    :    .    :    .    :    .    :
    198 AAATCCTTGAAGATTTACCACTTGTGTTTTGCAAGCCAGATTTTCCTGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187375 AAATCCTTGAAGATTTACCACTTGTGTTTTGCAAGCCAGATTTTCCTGAA

    250     .    :    .    :    .    :    .    :    .    :
    248 AACCCTTGCCATGTGCTAGTAATTGAAAAGGCAGCTCTAAATGTCAATCA
        ||||||||||||||||||||||||| ||||||||||||||||||||||||
 187425 AACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAATGTCAATCA

    300     .    :    .    :    .    :    .    :    .    :
    298 GCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATTTGTAGTGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187475 GCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATTTGTAGTGTT

    350     .    :    .    :    .    :    .    :    .    :
    348 GGAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTAAGTAATGATAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187525 GGAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTAAGTAATGATAA

    400     .    :    .    :    .    :    .    :    .    :
    398 CTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTTCTCTCCTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187575 CTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTTCTCTCCTCT

    450     .    :    .    :    .    :    .    :    .    :
    448 CCCCATGATGTTTAGAAACACAACTATATTGTTTGCTAAGCATTCCAACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187625 CCCCATGATGTTTAGAAACACAACTATATTGTTTGCTAAGCATTCCAACT

    500     .    :    .    :    .    :    .    :    .    :
    498 ATCTCATTTCCAAGCAAGTATTAGAATACCACAGGAACCACAAGACTGCG
        ||||||||||||||||||||||||||||||||||||||||||||||||| 
 187675 ATCTCATTTCCAAGCAAGTATTAGAATACCACAGGAACCACAAGACTGCA

    550     .    :    .    :    .    :    .    :    .    :
    548 CATCAAAATATGCCCCATTCAACATCCAGTGAGCAGTCAGGAAAGAGAAC
        |||||||||||||||||||||||||| |||||||||||||||||||||||
 187725 CATCAAAATATGCCCCATTCAACATCTAGTGAGCAGTCAGGAAAGAGAAC

    600     .    :    .    :    .    :    .    :    .    :
    598 TTCCAGATCCTGGAAATCAGGGTTAGTATTGTCCAGGTCTACCAAAAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||-|
 187775 TTCCAGATCCTGGAAATCAGGGTTAGTATTGTCCAGGTCTACCAAAAA T

    650     .    :    .    :    .
    648 CTCAATATTTCCGATTATCACAATAAATC
        ||||||||||| ||| ||||||||| |||
 187824 CTCAATATTTCAGATAATCACAATACATC

END