Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW377334.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW377334.1, 643 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6881997|gb|AW377334.1|AW377334 MR2-CT0222-281099-006-d10 CT0222 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-643  (187180-187823)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 TCATGGAATTGGAGCTCGTGGGACAGTCACCTCATGG ATTGGAGCTCGT
        |||||||||||||||||||||||||||||||||||||-||||||||||||
 187180 TCATGGAATTGGAGCTCGTGGGACAGTCACCTCATGGAATTGGAGCTCGT

     50     .    :    .    :    .    :    .    :    .    :
     50 GGAACAGTTACCTCTGCCTCAGAAAACAAGGATGAATTAAGTTTTTTTT 
        |||||||||||||||||||||||||||||||||||||||||||||||||-
 187230 GGAACAGTTACCTCTGCCTCAGAAAACAAGGATGAATTAAGTTTTTTTTT

    100     .    :    .    :    .    :    .    :    .    :
     99 AAAAAAGAAACATTTGGTAAGGGGAATTGAGGACACTGATATGGGTCTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187280 AAAAAAGAAACATTTGGTAAGGGGAATTGAGGACACTGATATGGGTCTTG

    150     .    :    .    :    .    :    .    :    .    :
    149 ATAAATGGCTTCCTGGCAATAGTCAAATTGTGTGAAAGGTACTTCAAATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187330 ATAAATGGCTTCCTGGCAATAGTCAAATTGTGTGAAAGGTACTTCAAATC

    200     .    :    .    :    .    :    .    :    .    :
    199 CTTGAAGATTTACCACTTGTGGTTTTGCAAGCCAGATTTTCCTGAAAACC
        ||||||||||||||||||||-|||||||||||||||||||||||||||||
 187380 CTTGAAGATTTACCACTTGT GTTTTGCAAGCCAGATTTTCCTGAAAACC

    250     .    :    .    :    .    :    .    :    .    :
    249 CTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAATGTCAATCAGCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187429 CTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAATGTCAATCAGCCT

    300     .    :    .    :    .    :    .    :    .    :
    299 AGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATTTGTAGTGTTGGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187479 AGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATTTGTAGTGTTGGAG

    350     .    :    .    :    .    :    .    :    .    :
    349 AAGAACTGAAATCATACTTCTTAGGGTTATGATTAAGTCATGATAACTGG
        |||||||||||||||||||||||||||||||||||||| |||||||||||
 187529 AAGAACTGAAATCATACTTCTTAGGGTTATGATTAAGTAATGATAACTGG

    400     .    :    .    :    .    :    .    :    .    :
    399 AAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTTCTCTCCTCTCCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187579 AAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTTCTCTCCTCTCCCC

    450     .    :    .    :    .    :    .    :    .    :
    449 ATGATGTTTAGAAACACAACTATATTGTTTGCTAAGCATTCCAACTATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187629 ATGATGTTTAGAAACACAACTATATTGTTTGCTAAGCATTCCAACTATCT

    500     .    :    .    :    .    :    .    :    .    :
    499 CATTTCCAAGCAAGTATTAGAATACCACAGGAACCACAAGACTGCGCATC
        ||||||||||||||||||||||||||||||||||||||||||||| ||||
 187679 CATTTCCAAGCAAGTATTAGAATACCACAGGAACCACAAGACTGCACATC

    550     .    :    .    :    .    :    .    :    .    :
    549 AAAATATGGCCCATTCAACATCTAGTGAGCAGTCAGGAAAGAGAACTTCC
        |||||||| |||||||||||||||||||||||||||||||||||||||||
 187729 AAAATATGCCCCATTCAACATCTAGTGAGCAGTCAGGAAAGAGAACTTCC

    600     .    :    .    :    .    :    .    :    .
    599 AGATCCTGGNAATCACGGGTAGTATTGTCCCGGGCTACCCAAAAT
        ||||||||| ||||| || ||||||||||| || ||||| |||||
 187779 AGATCCTGGAAATCAGGGTTAGTATTGTCCAGGTCTACCAAAAAT

END