Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW377339.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW377339.1, 661 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6882002|gb|AW377339.1|AW377339 MR2-CT0222-281099-006-b12 CT0222 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-661  (187163-187818)   95%

      0     .    :    .    :    .    :    .    :    .    :
      1 T ACCAGCGACATT GCTCATGGAATTGGAGCTCGTGCGACATGTCACCT
        |-||  | ||||||-|||||||||||||||||||||| ||||-|||||||
 187163 TGACATGGGACATTTGCTCATGGAATTGGAGCTCGTGGGACA GTCACCT

     50     .    :    .    :    .    :    .    :    .    :
     49 C TGGAATTGGAGCTCGTGGAACAGTTACCTCTGCCTCAGAAAACAAGGA
        |-||||||||||||||||||||||||||||||||||||||||||||||||
 187212 CATGGAATTGGAGCTCGTGGAACAGTTACCTCTGCCTCAGAAAACAAGGA

    100     .    :    .    :    .    :    .    :    .    :
     98 TGAATTAAGTTTTTTTTTAAAAAAGAAACATTTGGTAAGGGGGAATTGAG
        ||||||||||||||||||||||||||||||||||||||||||-|||||||
 187262 TGAATTAAGTTTTTTTTTAAAAAAGAAACATTTGGTAAGGGG AATTGAG

    150     .    :    .    :    .    :    .    :    .    :
    148 GACACTGATATGGGTCTTGATAATATGGCTTCCTGGCAATAGTCAATATT
        |||||||||||||||||||||||-||||||||||||||||||||||-|||
 187311 GACACTGATATGGGTCTTGATAA ATGGCTTCCTGGCAATAGTCAA ATT

    200     .    :    .    :    .    :    .    :    .    :
    198 GTGTGAAAGGTACTTCAAATCCTTGAAGATTTACCACTTGTGGTATTGCA
        |||||||||||||||||||||||||||||||||||||||||| |-|||||
 187359 GTGTGAAAGGTACTTCAAATCCTTGAAGATTTACCACTTGTGTT TTGCA

    250     .    :    .    :    .    :    .    :    .    :
    248 AGCCAGGATTTT CTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGC
        |||||-||||||-|||||||||||||||||||||||||||||||||||||
 187408 AGCCA GATTTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGC

    300     .    :    .    :    .    :    .    :    .    :
    297 AGCTCTAAATGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187457 AGCTCTAAATGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAAC

    350     .    :    .    :    .    :    .    :    .    :
    347 TCGTTAATTTGTAGTGTCGGAGAAGAACTGAAATCATACTTCTTAGGGTT
        ||||||||||||||||| ||||||||||||||||||||||||||||||||
 187507 TCGTTAATTTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTT

    400     .    :    .    :    .    :    .    :    .    :
    397 ATGATTGAGTGATGATAACTGGAAACTTCAGGCGGTTTATATAAGTCTTG
        |||||| ||| |||||||||||||||||||-||||||||||||||-||||
 187557 ATGATTAAGTAATGATAACTGGAAACTTCA GCGGTTTATATAAG CTTG

    450     .    :    .    :    .    :    .    :    .    :
    447 TATTCCTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187605 TATTCCTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATT

    500     .    :    .    :    .    :    .    :    .    :
    497 GTTTGCTAAGCATTCCAACTATCTCATTTCCAAGCAAGTTTTAGAATACC
        ||||||||||||||||||||||||||||||||||||||| ||||||||||
 187655 GTTTGCTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATACC

    550     .    :    .    :    .    :    .    :    .    :
    547 ACAGGAACCACAAGACTGCGCATCATAATAATGCCCCATTCAACATCTAG
        ||||||||||||||||||| ||||| ||||-|||||||||||||||||||
 187705 ACAGGAACCACAAGACTGCACATCAAAATA TGCCCCATTCAACATCTAG

    600     .    :    .    :    .    :    .    :    .    :
    597 TGAGGCGTCCGGAAAGAGAACTTCCAGATCCTGGAAATACAGG TTAGTA
        ||||  ||| ||||||||||||||||||||||||||||-||||-||||||
 187754 TGAGCAGTCAGGAAAGAGAACTTCCAGATCCTGGAAAT CAGGGTTAGTA

    650     .    :    .
    646 TTGTCCAGGTCTACCA
        ||||||||||||||||
 187803 TTGTCCAGGTCTACCA

END