Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW377372.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW377372.1, 661 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6882035|gb|AW377372.1|AW377372 MR2-CT0222-011199-007-a09 CT0222 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-661  (187178-187838)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 GCACATGGAATTGGAGCTCGTGGGACAG CACCTCAT GAATTGGAGCTC
        || |||||||||||||||||||||||||-||||||||-||||||||||||
 187178 GCTCATGGAATTGGAGCTCGTGGGACAGTCACCTCATGGAATTGGAGCTC

     50     .    :    .    :    .    :    .    :    .    :
     49 GTG ACAAAGTTACCTCTGCCTCAGAAAACAAGGATGAATTAATGTTTTT
        |||-|-| |||||||||||||||||||||||||||||||||||-||||||
 187228 GTGGA ACAGTTACCTCTGCCTCAGAAAACAAGGATGAATTAA GTTTTT

    100     .    :    .    :    .    :    .    :    .    :
     98 TTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAGGACACTGATATGGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187276 TTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAGGACACTGATATGGGT

    150     .    :    .    :    .    :    .    :    .    :
    148 CTTGATAAATGGCTTCCTGGCAATAGTCAAATTGTGTGAAAGGTACTTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187326 CTTGATAAATGGCTTCCTGGCAATAGTCAAATTGTGTGAAAGGTACTTCA

    200     .    :    .    :    .    :    .    :    .    :
    198 AATCCTTGAAGATTTACCACTTGTGGTTTTGCAAGCCAGATTTTCCTGAA
        ||||||||||||||||||||||||-|||||||||||||||||||||||||
 187376 AATCCTTGAAGATTTACCACTTGT GTTTTGCAAGCCAGATTTTCCTGAA

    250     .    :    .    :    .    :    .    :    .    :
    248 AACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAATGTCAATCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187425 AACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAATGTCAATCA

    300     .    :    .    :    .    :    .    :    .    :
    298 GCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATTTGTGGTGTT
        |||||||||||||||||||||||||||||||||||||||||||| |||||
 187475 GCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATTTGTAGTGTT

    350     .    :    .    :    .    :    .    :    .    :
    348 GGTGAAGAACTGAAATCATACTTCTTAGGGTTATGATTAAGTAATGATAA
        || |||||||||||||||||||||||||||||||||||||||||||||||
 187525 GGAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTAAGTAATGATAA

    400     .    :    .    :    .    :    .    :    .    :
    398 CTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTTCTCTCCTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187575 CTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTTCTCTCCTCT

    450     .    :    .    :    .    :    .    :    .    :
    448 CCCCATGATGTTTAGAAACACAACTATATTGTTTGCTAAGCATTCCAACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187625 CCCCATGATGTTTAGAAACACAACTATATTGTTTGCTAAGCATTCCAACT

    500     .    :    .    :    .    :    .    :    .    :
    498 ATCTCATTTCCAAGCGAGTATTAGAATACCACAGGAACCACAAGACTGCA
        ||||||||||||||| ||||||||||||||||||||||||||||||||||
 187675 ATCTCATTTCCAAGCAAGTATTAGAATACCACAGGAACCACAAGACTGCA

    550     .    :    .    :    .    :    .    :    .    :
    548 CATCAAAAAATGCCCCATTCAACATCTAGTGAGCAGTCAGGAAAGAGAAC
        |||||||| |||||||||||||||||||||||||||||||||||||||||
 187725 CATCAAAATATGCCCCATTCAACATCTAGTGAGCAGTCAGGAAAGAGAAC

    600     .    :    .    :    .    :    .    :    .    :
    598 TTCCAGATCCTGGAAATCCAGGTTAGTATTGTCCAGGTCTACCAAAAATC
        ||||||||||||||||||  ||||||||||||||||||||||||||||||
 187775 TTCCAGATCCTGGAAATCAGGGTTAGTATTGTCCAGGTCTACCAAAAATC

    650     .    :
    648 TCAATATTTCAGAT
        ||||||||||||||
 187825 TCAATATTTCAGAT

END