Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW377383.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW377383.1, 664 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6882046|gb|AW377383.1|AW377383 MR2-CT0222-011199-007-f04 CT0222 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

(complement)

1-664  (687-1355)   95%

      0     .    :    .    :    .    :    .    :    .    :
      1 CCAGCGAC ATTTGCACTAACATACTTT CCAGCTCAACTCTAGGTCAAA
        || | |||-|||||||||||||||||||-|||||| |||||||| |||||
    687 CCTGTGACAATTTGCACTAACATACTTTTCCAGCTAAACTCTAGTTCAAA

     50     .    :    .    :    .    :    .    :    .    :
     49 GGTCTGTGAGCTATGT ACTTTCTGGAGTTGGGAAAAGGCATATCAACTT
        ||||||||||||-|||-|||||||||||||||||||||||||||||||||
    737 GGTCTGTGAGCT TGTCACTTTCTGGAGTTGGGAAAAGGCATATCAACTT

    100     .    :    .    :    .    :    .    :    .    :
     98 CTTCATCAAGGGAA CATCCTGTCCCCTTGTGAAAGATTATAACAGCCCT
        ||||||||||||||-|||||||||||||-|||||||||||||||||||||
    786 CTTCATCAAGGGAACCATCCTGTCCCCT GTGAAAGATTATAACAGCCCT

    150     .    :    .    :    .    :    .    :    .    :
    147 TTCCCAGGTAAGGGATGTATTGTGATTATCTGAAATATTAGAGATTTTTG
        |||||||||||||||||||||||||||||||||||||||-||||||||||
    835 TTCCCAGGTAAGGGATGTATTGTGATTATCTGAAATATT GAGATTTTTG

    200     .    :    .    :    .    :    .    :    .    :
    197 GTAGACCTGGACAATACTAACCCTGATTTCCAGGATCTGGAACTTCTCTT
        |||||||||||||||||||||||||||||||||||||||||| |||||||
    884 GTAGACCTGGACAATACTAACCCTGATTTCCAGGATCTGGAAGTTCTCTT

    250     .    :    .    :    .    :    .    :    .    :
    247 TCCTGACTGCTCACTAGATGTTGAATGGGGCATATTTTGATGTGCAGTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    934 TCCTGACTGCTCACTAGATGTTGAATGGGGCATATTTTGATGTGCAGTCT

    300     .    :    .    :    .    :    .    :    .    :
    297 TGTGGTTCCTGTGGTATTCTAATACTTGCTTGGAAATGAGATAGTTGGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    984 TGTGGTTCCTGTGGTATTCTAATACTTGCTTGGAAATGAGATAGTTGGAA

    350     .    :    .    :    .    :    .    :    .    :
    347 TGCTTAGCAAAACAATATAGTTGTGTTTCTAAACATCATGGGGAGAGGAG
        |||||||||||-||||||||||||||||||||||||||||||||||||||
   1034 TGCTTAGCAAA CAATATAGTTGTGTTTCTAAACATCATGGGGAGAGGAG

    400     .    :    .    :    .    :    .    :    .    :
    397 AGAAAAAGGCATACAAGCTTATATAAACCGGTGAAGTTTCCAGTTATCAT
        ||||||||| |||||||||||||||||||| |||||||||||||||||||
   1083 AGAAAAAGGAATACAAGCTTATATAAACCGCTGAAGTTTCCAGTTATCAT

    450     .    :    .    :    .    :    .    :    .    :
    447 TACTTAATCATAACCCTAAGAAGTATGATCTCAGTTCTTCTCCAACACTA
        ||||||||||||||||||||||||||||| ||||||||||||||||||||
   1133 TACTTAATCATAACCCTAAGAAGTATGATTTCAGTTCTTCTCCAACACTA

    500     .    :    .    :    .    :    .    :    .    :
    497 CAAATTAACGAGTTTCACTAGACAATAAGCTGATCAACTAGGCTGATTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1183 CAAATTAACGAGTTTCACTAGACAATAAGCTGATCAACTAGGCTGATTGA

    550     .    :    .    :    .    :    .    :    .    :
    547 CATTTAGAGCTGTCTTTCCAATTACTAGCACATGGCAAGGGTTTTCAGGA
        |||||||||||| |||||||||||||||||||||||||||||||||||||
   1233 CATTTAGAGCTGCCTTTCCAATTACTAGCACATGGCAAGGGTTTTCAGGA

    600     .    :    .    :    .    :    .    :    .    :
    597 AAATCTGG GTGCAAAAGACAAGTTGTAA TCTTCAAGG TTTGAAGTAC
        ||||||||- ||||||| |||||| ||||-|||||||||-||||||||||
   1283 AAATCTGGCTTGCAAAACACAAGTGGTAAATCTTCAAGGATTTGAAGTAC

    650     .    :    .    :
    644  TTTCACACA TTTGA TATTGCA
        -|||||||||-|||||-||||||-
   1333 CTTTCACACAATTTGACTATTGC 

END