Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW377387.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW377387.1, 623 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6882050|gb|AW377387.1|AW377387 MR2-CT0222-011199-007-g05 CT0222 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-623  (187207-187828)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 CACCGTCATG AATTGGAGCTCGTGGAAAAGTTACCTCTGCCTCAGAAAA
        ||||-|||||-||||||||||||||||| |||||||||||||||||||||
 187207 CACC TCATGGAATTGGAGCTCGTGGAACAGTTACCTCTGCCTCAGAAAA

     50     .    :    .    :    .    :    .    :    .    :
     50 CAAGGATGAATTAAGTTTATTTTTAAAAAAGAAACATTGGGTAAGGGGAA
        |||||||||||||||||| ||||||||||||||||||| |||||||||||
 187256 CAAGGATGAATTAAGTTTTTTTTTAAAAAAGAAACATTTGGTAAGGGGAA

    100     .    :    .    :    .    :    .    :    .    :
    100 TTGAGGACACTGTTATGGGTCTTGATAAATGGCTTCCTGGCAATAGTCAA
        |||||||||||| |||||||||||||||||||||||||||||||||||||
 187306 TTGAGGACACTGATATGGGTCTTGATAAATGGCTTCCTGGCAATAGTCAA

    150     .    :    .    :    .    :    .    :    .    :
    150 ATTGTGTGAAAGGTACTTCAAATCCTTGAAGATTTACCACTTGTGGTTTT
        ||||||||||||||||||||||||||||||||||||||||||||-|||||
 187356 ATTGTGTGAAAGGTACTTCAAATCCTTGAAGATTTACCACTTGT GTTTT

    200     .    :    .    :    .    :    .    :    .    :
    200 GCAAGCCAGATTTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187405 GCAAGCCAGATTTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAG

    250     .    :    .    :    .    :    .    :    .    :
    250 GCAGCTCTAAATGTCAATCACCCTAGTTGATCAGCTTATTGTCTAGTGAA
        |||||||||||||||||||| |||||||||||||||||||||||||||||
 187455 GCAGCTCTAAATGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAA

    300     .    :    .    :    .    :    .    :    .    :
    300 ACTCGTTAATTTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187505 ACTCGTTAATTTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGG

    350     .    :    .    :    .    :    .    :    .    :
    350 TTATGATTAAGTAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187555 TTATGATTAAGTAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTG

    400     .    :    .    :    .    :    .    :    .    :
    400 TATTCCTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187605 TATTCCTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATT

    450     .    :    .    :    .    :    .    :    .    :
    450 GTTTGCTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187655 GTTTGCTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATACC

    500     .    :    .    :    .    :    .    :    .    :
    500 ACAGGAACCACAAGACTGCACATCAAAAAATGCCCCATTCAACATCTAGT
        |||||||||||||||||||||||||||| |||||||||||||||||||||
 187705 ACAGGAACCACAAGACTGCACATCAAAATATGCCCCATTCAACATCTAGT

    550     .    :    .    :    .    :    .    :    .    :
    550 GAGCAGTCAGGAAAGAGAACTTCCAGATCCTGGACATCAGGGTTAGTATT
        |||||||||||||||||||||||||||||||||| |||||||||||||||
 187755 GAGCAGTCAGGAAAGAGAACTTCCAGATCCTGGAAATCAGGGTTAGTATT

    600     .    :    .    :
    600 GTCCAGGTCTACCAGAGATCTCAA
        |||||||||||||| | |||||||
 187805 GTCCAGGTCTACCAAAAATCTCAA

END