Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW408596.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW408596.1, 308 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|6927653|gb|AW408596.1|AW408596 UI-HF-BM0-adv-a-08-0-UI.r1 NIH_MGC_38 Homo sapiens cDNA clone IMAGE:3062703 5', mRNA sequence
>ENSG00000012048

1-308  (567-875)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 CA CGAGGCTCACTGCAACCTCCACCTCCCGGGCTGAAGTGATTCTCCTG
         |-|  ||||||||||||||||||||||||||||||||||||||||||||
    567 GATCTTGGCTCACTGCAACCTCCACCTCCCGGGCTGAAGTGATTCTCCTG

     50     .    :    .    :    .    :    .    :    .    :
     50 CCTTAGCCACCTGAGTAGCTGGGATTACAGGTGTCCACCACCATGACCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    617 CCTTAGCCACCTGAGTAGCTGGGATTACAGGTGTCCACCACCATGACCGG

    100     .    :    .    :    .    :    .    :    .    :
    100 CTAATTTCTGTATTTTTAGTAGAGATGGGGTTTCACCATGTTGGCCAGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    667 CTAATTTCTGTATTTTTAGTAGAGATGGGGTTTCACCATGTTGGCCAGGC

    150     .    :    .    :    .    :    .    :    .    :
    150 TGGTTTCGAACTCCTGACCTCCAGTGATCTGCCCACCTTGGCCTCCCAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    717 TGGTTTCGAACTCCTGACCTCCAGTGATCTGCCCACCTTGGCCTCCCAAA

    200     .    :    .    :    .    :    .    :    .    :
    200 GTGCTGGGATTACAGGCGTGAGCCACCATGCCCAGGTTTCAAGTTTCCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    767 GTGCTGGGATTACAGGCGTGAGCCACCATGCCCAGGTTTCAAGTTTCCTT

    250     .    :    .    :    .    :    .    :    .    :
    250 TTCATTTCTAAAACCTGCCTCAGAATTTCCTCCCCAATGGTCCACTCCAA
        ||||||||||| ||||||||||||||||||||||||||| ||||||||||
    817 TTCATTTCTAATACCTGCCTCAGAATTTCCTCCCCAATGTTCCACTCCAA

    300     .
    300 CATTTGATA
        ||||||| |
    867 CATTTGAGA

END