Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW514868.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW514868.1, 469 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|7152950|gb|AW514868.1|AW514868 xu99g04.x1 NCI_CGAP_Ut2 Homo sapiens cDNA clone IMAGE:2809878 3' similar to contains Alu repetitive element;, mRNA sequence
>ENSG00000012048

1-469  (521-989)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 TTTGAGCCACAGTCTCACTGTCACCCAGGCTGGAGTGCCGTGGTATGATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    521 TTTGAGCCACAGTCTCACTGTCACCCAGGCTGGAGTGCCGTGGTATGATC

     50     .    :    .    :    .    :    .    :    .    :
     51 TTGGCTCACTGCAACCTCCACCTCCCGGGCTGAAGTGATTCTCCTGCCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    571 TTGGCTCACTGCAACCTCCACCTCCCGGGCTGAAGTGATTCTCCTGCCTT

    100     .    :    .    :    .    :    .    :    .    :
    101 AGCCACCTGAGTAGCTGGGATTACAGGTGTCCACCACCATGACCGGCTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    621 AGCCACCTGAGTAGCTGGGATTACAGGTGTCCACCACCATGACCGGCTAA

    150     .    :    .    :    .    :    .    :    .    :
    151 TTTCTGTATTTTTAGTAGAGATGGGGTTTCACCATGTTGGCCAGGCTGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    671 TTTCTGTATTTTTAGTAGAGATGGGGTTTCACCATGTTGGCCAGGCTGGT

    200     .    :    .    :    .    :    .    :    .    :
    201 TTCGAACTCCTGACCTCCAGTGATCTGCCCACCTTGGCCTCCCAAAGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    721 TTCGAACTCCTGACCTCCAGTGATCTGCCCACCTTGGCCTCCCAAAGTGC

    250     .    :    .    :    .    :    .    :    .    :
    251 TGGGATTACAGGCGTGAGCCACCATGCCCAGGTTTCAAGTTTCCTTTTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    771 TGGGATTACAGGCGTGAGCCACCATGCCCAGGTTTCAAGTTTCCTTTTCA

    300     .    :    .    :    .    :    .    :    .    :
    301 TTTCTAATACCTGCCTCAGAATTTCCTCCCCAATGTTCCACTCCAACATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    821 TTTCTAATACCTGCCTCAGAATTTCCTCCCCAATGTTCCACTCCAACATT

    350     .    :    .    :    .    :    .    :    .    :
    351 TGAGAACTGCCCAAGGACTATTCTGACTTTAAGTCACATAATCGATCCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    871 TGAGAACTGCCCAAGGACTATTCTGACTTTAAGTCACATAATCGATCCCA

    400     .    :    .    :    .    :    .    :    .    :
    401 AGCACTCTCCTTCCATTGAAGGGTCTGACTCTCTGCCTTTGTGAACACAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    921 AGCACTCTCCTTCCATTGAAGGGTCTGACTCTCTGCCTTTGTGAACACAG

    450     .    :    .
    451 GGTTTTAGAGAAGTAAACT
        |||||||||||||||||||
    971 GGTTTTAGAGAAGTAAACT

END