Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW517507.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW517507.1, 332 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|7155589|gb|AW517507.1|AW517507 xq10f10.x1 NCI_CGAP_Ut1 Homo sapiens cDNA clone IMAGE:2750251 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);contains element MSR1 repetitive element ;, mRNA sequence
>ENSG00000017427

218-241  (51045-51068)   83% ==
302-332  (53969-53999)   100%

      0     .    :    .    :
    218 GCTTTTTGTTTGTTTGTTTGTTTT
        ||||    ||||||||||||||||
  51045 GCTTGGCATTTGTTTGTTTGTTTT

      0     .    :    .    :    .    :
    302 TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
        |||||||||||||||||||||||||||||||
  53969 TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT

END