Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW673569.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW673569.1, 349 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|7538804|gb|AW673569.1|AW673569 ba55d11.y3 NIH_MGC_10 Homo sapiens cDNA clone IMAGE:2900469 5' similar to gb:U36475 Mus musculus breast and ovarian cancer susceptibility protein (MOUSE);, mRNA sequence
>ENSG00000012048

(complement)

1-349  (80743-81091)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGCTCTGGTATATAATCCATTCCTCTTAAAATATAAGACCTCTGGCATGA
         |||||||||||||||||||||||||||||||||||||||||||||||||
  80743 AGCTCTGGTATATAATCCATTCCTCTTAAAATATAAGACCTCTGGCATGA

     50     .    :    .    :    .    :    .    :    .    :
     51 ATATTTCATATCTATAAAATGACAGATCCCACCAAGAAGGAAGCTGTTGC
        |||||||||||||||||||||||||||||||||| |||||||||||||||
  80793 ATATTTCATATCTATAAAATGACAGATCCCACCAGGAAGGAAGCTGTTGC

    100     .    :    .    :    .    :    .    :    .    :
    101 TTTCTTTGAGGTGATTTTTTTCCTTTGCTCCCTGTTGCTGAAACCATACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80843 TTTCTTTGAGGTGATTTTTTTCCTTTGCTCCCTGTTGCTGAAACCATACA

    150     .    :    .    :    .    :    .    :    .    :
    151 GCTTCATAAATAATTTTGCTTGCTGAAGGAAGAAAAAGTGTTTTTCATAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80893 GCTTCATAAATAATTTTGCTTGCTGAAGGAAGAAAAAGTGTTTTTCATAA

    200     .    :    .    :    .    :    .    :    .    :
    201 ACCCATTATCCAGGACTGTTTATAGCTGTTGGAAGGACTAGGTCTTCCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80943 ACCCATTATCCAGGACTGTTTATAGCTGTTGGAAGGACTAGGTCTTCCCT

    250     .    :    .    :    .    :    .    :    .    :
    251 AGCCCCCCTAGTGTGCAAGGGCAGTGAAGACTTGATTGTACAAAATACGT
        |||||||| |||||||||||||||||||||||||||||||||||||||||
  80993 AGCCCCCCCAGTGTGCAAGGGCAGTGAAGACTTGATTGTACAAAATACGT

    300     .    :    .    :    .    :    .    :    .
    301 TTTGTAAATGTTGTGCTGTTAACACTGCAAATAAACTTGGTAGCAAACA
        |||||||||||||||||||||||||||||||||||||||||||||||||
  81043 TTTGTAAATGTTGTGCTGTTAACACTGCAAATAAACTTGGTAGCAAACA

END