Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW750505.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW750505.1, 522 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|7665437|gb|AW750505.1|AW750505 RC5-CN0011-110100-031-A03 CN0011 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-522  (188013-188533)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 TACAGCCCTTATTTCCACAGAAGCTCCAGATAGTTTTTGTGTAAGTAGAT
         ||||||||| |||||||||||||||||| |||    |||||||||||||
 188013 GACAGCCCTTCTTTCCACAGAAGCTCCAGGTAGAGGGTGTGTAAGTAGAT

     50     .    :    .    :    .    :    .    :    .    :
     51 AGGCCATGGGCACGTGTGGGTAGACACACATGAAGTCCAAGCATTTAGAT
        |||||||||||||-||||||||||||||||||||||||||||||||||||
 188063 AGGCCATGGGCAC TGTGGGTAGACACACATGAAGTCCAAGCATTTAGAT

    100     .    :    .    :    .    :    .    :    .    :
    101 GTATAGGCTGATGGTGGTATGTTTTCAGGCTAGATGTATGTACTTCATGC
        ||||||| ||||||||||||||||||||||||||||||||||||||||||
 188112 GTATAGGTTGATGGTGGTATGTTTTCAGGCTAGATGTATGTACTTCATGC

    150     .    :    .    :    .    :    .    :    .    :
    151 TGTCTACACTAAGAGAGAATGAGAGACACACTGAAGAAGCACCAATCATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188162 TGTCTACACTAAGAGAGAATGAGAGACACACTGAAGAAGCACCAATCATG

    200     .    :    .    :    .    :    .    :    .    :
    201 AATTAGTTTTATATGCTTCTGTTTTATAATTTTGTGAAGCAAAATTTTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188212 AATTAGTTTTATATGCTTCTGTTTTATAATTTTGTGAAGCAAAATTTTTT

    250     .    :    .    :    .    :    .    :    .    :
    251 CTCTAGGAAATATTTATTTTAATAATGTTTCAAACATATATAACAATGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188262 CTCTAGGAAATATTTATTTTAATAATGTTTCAAACATATATAACAATGCT

    300     .    :    .    :    .    :    .    :    .    :
    301 GTATTTTAAAAGAATGATTATGAATTACATTTGTATAAAATAATTTTTAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188312 GTATTTTAAAAGAATGATTATGAATTACATTTGTATAAAATAATTTTTAT

    350     .    :    .    :    .    :    .    :    .    :
    351 ATTTGAAATATCGACTTTTTATGGCACTAGTATTTCTATGAAATATTATG
        ||||||||||| ||||||||||||||||||||||||||||||||||||||
 188362 ATTTGAAATATTGACTTTTTATGGCACTAGTATTTCTATGAAATATTATG

    400     .    :    .    :    .    :    .    :    .    :
    401 TTAAAACTGGGACAGGGGAGAACCTAGGGTGATATTAACCAGGGGCCATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188412 TTAAAACTGGGACAGGGGAGAACCTAGGGTGATATTAACCAGGGGCCATG

    450     .    :    .    :    .    :    .    :    .    :
    451 AATCACCTTTTGGGCTGGAGGGAAGCCTTGGGGCTGATGCAGTTGTTGCC
        ||||||||||||| ||||||||||||||||||||||||||||||||||||
 188462 AATCACCTTTTGGTCTGGAGGGAAGCCTTGGGGCTGATGCAGTTGTTGCC

    500     .    :    .    :
    501 CACAGCTGTTTGATTCCCAGCC
        ||||||||| ||||||||||||
 188512 CACAGCTGTATGATTCCCAGCC

END