Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW752894.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW752894.1, 676 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|7667826|gb|AW752894.1|AW752894 MR2-CT0222-201099-001-h04 CT0222 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

7-674  (187172-187839)   96%

      0     .    :    .    :    .    :    .    :    .    :
      7 ACAGTTTGCTTCATGG ATTGGAGCTCGTGGGACAGTCACCTCATGGAAT
        |||-||||||-|||||-|||||||||||||||||||||||||||||||||
 187172 ACA TTTGCT CATGGAATTGGAGCTCGTGGGACAGTCACCTCATGGAAT

     50     .    :    .    :    .    :    .    :    .    :
     56 TGGAGCTCGTGGA CACGTTACCTCTGCCTCAGAAAACAAGGATGAATTA
        |||||||||||||-||-|||||||||||||||||||||||||||||||||
 187220 TGGAGCTCGTGGAACA GTTACCTCTGCCTCAGAAAACAAGGATGAATTA

    100     .    :    .    :    .    :    .    :    .    :
    105 AG TTTTTTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAGGACACTGA
        ||-|||||||||||||||||||||||||||||||||||||||||||||||
 187269 AGTTTTTTTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAGGACACTGA

    150     .    :    .    :    .    :    .    :    .    :
    154 TATGGGTCTTGATAAAGTGGCTTCCTGGCANATAGTCAAATTCGTGTGAA
        ||||||||||||||||-|||||||||||||-|||||||||||-|||||||
 187319 TATGGGTCTTGATAAA TGGCTTCCTGGCA ATAGTCAAATT GTGTGAA

    200     .    :    .    :    .    :    .    :    .    :
    204 AGGTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTTGGCAAGCCAGA
        |||||||||||||||||||||||||||||||||||||||-||||||||||
 187366 AGGTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTT GCAAGCCAGA

    250     .    :    .    :    .    :    .    :    .    :
    254 TTTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187415 TTTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAA

    300     .    :    .    :    .    :    .    :    .    :
    304 ATTGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAA
        ||-|||||||||||||||||||||||||||||||||||||||||||||||
 187465 AT GTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAA

    350     .    :    .    :    .    :    .    :    .    :
    354 TTTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187514 TTTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTA

    400     .    :    .    :    .    :    .    :    .    :
    404 AGTAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187564 AGTAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTT

    450     .    :    .    :    .    :    .    :    .    :
    454 TTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATTGTTTGCTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187614 TTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATTGTTTGCTAA

    500     .    :    .    :    .    :    .    :    .    :
    504 GCATTCCAACTATCTCATTTCCAAGCAAGTTTTAGAATACCACAGGGACC
        |||||||||||||||||||||||||||||| ||||||||||||||| |||
 187664 GCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATACCACAGGAACC

    550     .    :    .    :    .    :    .    :    .    :
    554 ACAAGAGTGCCCATCAAAATATGGCCCATTCAACATCTAGTGAGCAGTCC
        |||||| ||| |||||||||||| ||||||||||||||||||||||||| 
 187714 ACAAGACTGCACATCAAAATATGCCCCATTCAACATCTAGTGAGCAGTCA

    600     .    :    .    :    .    :    .    :    .    :
    604 GGAAAGAGAACTTCCAGATCCTGGAGAACAGGGT AGGATTGTCCAGG C
        ||||||||||||||||||||||||| | ||||||-|| ||||||||||-|
 187764 GGAAAGAGAACTTCCAGATCCTGGAAATCAGGGTTAGTATTGTCCAGGTC

    650     .    :    .    :    .
    652 TAC AAAAAACTC ATATTTC GATA
        |||-||||| |||-|||||||-||||
 187814 TACCAAAAATCTCAATATTTCAGATA

END