Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW805230.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW805230.1, 421 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|7857100|gb|AW805230.1|AW805230 QV1-UM0099-110400-144-h06 UM0099 Homo sapiens cDNA, mRNA sequence
>ENSG00000140443

9-421  (261803-262216)   97%

      0     .    :    .    :    .    :    .    :    .    :
      9 GTCGAA AATCGCATCATCATAACCTGGCAC G TACCGGCCCCCTGACT
        ||||||-||||||||||||||||||||||||-|-||||||||||||||||
 261803 GTCGAAGAATCGCATCATCATAACCTGGCACCGGTACCGGCCCCCTGACT

     50     .    :    .    :    .    :    .    :    .    :
     56 ACAGTGATCTCATCAGCTTCACCGTTTACTACAAGGAAGCGTGAGTTTCT
        |||| |||||||||||||||||||||||||||||||||||||||||||||
 261853 ACAGGGATCTCATCAGCTTCACCGTTTACTACAAGGAAGCGTGAGTTTCT

    100     .    :    .    :    .    :    .    :    .    :
    106 CGCTTTGGGTGATGCCATTCTGTTGACAGGGCTACGAATGGGAGAGGCCA
        -|||||||||||||||||||||||||||||||||||||||||||||||||
 261903  GCTTTGGGTGATGCCATTCTGTTGACAGGGCTACGAATGGGAGAGGCCA

    150     .    :    .    :    .    :    .    :    .    :
    156 GTCTTTCGATCCTTGAATGGGCTGGCTGAATACAGGGGGTCAGCAGAGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 261952 GTCTTTCGATCCTTGAATGGGCTGGCTGAATACAGGGGGTCAGCAGAGTC

    200     .    :    .    :    .    :    .    :    .    :
    206 CCCAGGGAGAGCCACGCCAAACATCCCTACTTCATCCTCATGCACCCTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 262002 CCCAGGGAGAGCCACGCCAAACATCCCTACTTCATCCTCATGCACCCTCT

    250     .    :    .    :    .    :    .    :    .    :
    256 CGGGCTGTCCCTGTGATGTCAGTCACAGCCAGTGACAGCCATGATTGGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 262052 CGGGCTGTCCCTGTGATGTCAGTCACAGCCAGTGACAGCCATGATTGGGA

    300     .    :    .    :    .    :    .    :    .    :
    306 AAGTGTTAGCTCGAGGCCTGTCATTCTTTAGTGAGTGATTAGAGATGTTT
        |||||||||||||||||||||||||||||||||||||||||||| |||||
 262102 AAGTGTTAGCTCGAGGCCTGTCATTCTTTAGTGAGTGATTAGAGGTGTTT

    350     .    :    .    :    .    :    .    :    .    :
    356 GAATTAAATAAACCCAAAATGGGGAAAGCCTGCTTTTTCCAGAATTAGGT
        |||| |||||||||||||||||||||||| ||||||||||||||||||||
 262152 GAATAAAATAAACCCAAAATGGGGAAAGCTTGCTTTTTCCAGAATTAGGT

    400     .    :    .
    406 CAGTCCAGACTCAGTG
        |||||||||||||-||
 262202 CAGTCCAGACTCA TG

END