Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW852058.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW852058.1, 435 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|7947575|gb|AW852058.1|AW852058 QV0-CT0225-090200-086-c03 CT0225 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

28-140  (185492-185602)   97% ->
141-435  (186946-187240)   100%

      0     .    :    .    :    .    :    .    :    .    :
     28 TCCAGATAACATACCAAATAATTAGAAGAACTCTAAAACAAGCATTTGCT
        || ||--|||||||||||||||||||||||||||||||||||||||||||
 185492 TCTAG  AACATACCAAATAATTAGAAGAACTCTAAAACAAGCATTTGCT

     50     .    :    .    :    .    :    .    :    .    :
     78 GATTGCACAGTAATTCTCTGTGAACACAGGATAGAAGCAATGCTGGAATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 185540 GATTGCACAGTAATTCTCTGTGAACACAGGATAGAAGCAATGCTGGAATG

    100     .    :    .    :    .    :    .    :    .    :
    128 CCAACAATTTTTG         GTCATAGAAGAGAACAAAGTGCGGCAGT
        |||||||||||||>>>...>>>||||||||||||||||||||||||||||
 185590 CCAACAATTTTTGGTG...TAGGTCATAGAAGAGAACAAAGTGCGGCAGT

    150     .    :    .    :    .    :    .    :    .    :
    169 ACGATTCCATCCAGAAACTGCTGAACGAGAGGAGCCTCTTCCGGCAAGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 186974 ACGATTCCATCCAGAAACTGCTGAACGAGAGGAGCCTCTTCCGGCAAGCC

    200     .    :    .    :    .    :    .    :    .    :
    219 ATCAGCCCCTCCGACAGGGTGAAGCTCTTTCCCCACCGGAACTCAAGCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187024 ATCAGCCCCTCCGACAGGGTGAAGCTCTTTCCCCACCGGAACTCAAGCAA

    250     .    :    .    :    .    :    .    :    .    :
    269 GTGCAAGTCTAAGCCCCAGATTGCTGCTCTGAAAGAGGAGACAGAAGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187074 GTGCAAGTCTAAGCCCCAGATTGCTGCTCTGAAAGAGGAGACAGAAGAAG

    300     .    :    .    :    .    :    .    :    .    :
    319 AGGTGCAAGATACAAGGCTTTAGAGAGCAGCATAAATGTTGACATGGGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187124 AGGTGCAAGATACAAGGCTTTAGAGAGCAGCATAAATGTTGACATGGGAC

    350     .    :    .    :    .    :    .    :    .    :
    369 ATTTGCTCATGGAATTGGAGCTCGTGGGACAGTCACCTCATGGAATTGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187174 ATTTGCTCATGGAATTGGAGCTCGTGGGACAGTCACCTCATGGAATTGGA

    400     .    :    .
    419 GCTCGTGGAACAGTTAC
        |||||||||||||||||
 187224 GCTCGTGGAACAGTTAC

END