Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW858521.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW858521.1, 345 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|7954214|gb|AW858521.1|AW858521 CM3-CT0341-150300-119-c04 CT0341 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-345  (187793-188128)   96%

      0     .    :    .    :    .    :    .    :    .    :
      1 AGCTTTACCGCTATTGTCCAGGTCTACCAAAAATCTCAATATTTCAGATA
        ||  |||--|-|||||||||||||||||||||||||||||||||||||||
 187793 AGGGTTA  G TATTGTCCAGGTCTACCAAAAATCTCAATATTTCAGATA

     50     .    :    .    :    .    :    .    :    .    :
     51 ATCACAATACATCCCTTACCTGGGAAAGGGCTGTTATAATCTTTCACAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187840 ATCACAATACATCCCTTACCTGGGAAAGGGCTGTTATAATCTTTCACAGG

    100     .    :    .    :    .    :    .    :    .    :
    101 GGACAGGATGGTTCCCNTTGATGAAGAAGTTGATATGCCTTTTCCCAACT
        ||||||||||||||||-|||||||||||||||||||||||||||||||||
 187890 GGACAGGATGGTTCCC TTGATGAAGAAGTTGATATGCCTTTTCCCAACT

    150     .    :    .    :    .    :    .    :    .    :
    151 CCAGAAAGTGACAAGCTCACAGACCTTTGAACTAGAGTTTAGCTGGAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187939 CCAGAAAGTGACAAGCTCACAGACCTTTGAACTAGAGTTTAGCTGGAAAA

    200     .    :    .    :    .    :    .    :    .    :
    201 GTATGTTAGTGCAACACTTGCTCACAGGACNATGCCCTTCTTTCCACAGA
        ||||||||||||||-|-|||-|||||||||-|-|||||||||||||||||
 187989 GTATGTTAGTGCAA A TTG TCACAGGAC A GCCCTTCTTTCCACAGA

    250     .    :    .    :    .    :    .    :    .    :
    251 AGCTCCAGGTAGAGGGTGTGTAAGTAGATAGGCCATGGGCACTGTGGGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188034 AGCTCCAGGTAGAGGGTGTGTAAGTAGATAGGCCATGGGCACTGTGGGTA

    300     .    :    .    :    .    :    .    :    .
    301 GACACACATGAAGTCCAAGCATTTAGATGTATAGGTTGATGGCGG
        |||||||||||||||||||||||||||||||||||||||||| ||
 188084 GACACACATGAAGTCCAAGCATTTAGATGTATAGGTTGATGGTGG

END