Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW901336.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW901336.1, 348 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|8065450|gb|AW901336.1|AW901336 CM4-NN1011-100300-109-c01 NN1011 Homo sapiens cDNA, mRNA sequence
>ENSG00000140443

(complement)

1-348  (250375-250723)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 AGCATTTT C CAATCCTGATGGCCCCCCGAGTAATGTTCCTCAGGTTGT
        ||||||||-|-|||||||||||||||||||||||||||||||||||||||
 250375 AGCATTTTTCTCAATCCTGATGGCCCCCCGAGTAATGTTCCTCAGGTTGT

     50     .    :    .    :    .    :    .    :    .    :
     49 AAAGCCCAATATCCTTGAGATTGGTCATCTCGAAGATGACCA GGCGTAG
        ||||||||||||||||||||||||||||||||||||||||||-|||||||
 250425 AAAGCCCAATATCCTTGAGATTGGTCATCTCGAAGATGACCAGGGCGTAG

    100     .    :    .    :    .    :    .    :    .    :
     98 TTGTAGAAGAGTT CCAGCCGCGGATGACCGTGAGGTTGGGGAAGAGGTC
        |||||||||||||-||||||||||||||||||||||||||||||||||||
 250475 TTGTAGAAGAGTTTCCAGCCGCGGATGACCGTGAGGTTGGGGAAGAGGTC

    150     .    :    .    :    .    :    .    :    .    :
    147 TCCGAGGCTCTCGAGGCCAGCCACTCGGAACAGCAGCAAGTACTCGGTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 250525 TCCGAGGCTCTCGAGGCCAGCCACTCGGAACAGCAGCAAGTACTCGGTAA

    200     .    :    .    :    .    :    .    :    .    :
    197 TGACCGTGAGCTTGGGGAAGCGGTAGCTGCGGTAGTCCTCGGCCTTGGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 250575 TGACCGTGAGCTTGGGGAAGCGGTAGCTGCGGTAGTCCTCGGCCTTGGAG

    250     .    :    .    :    .    :    .    :    .    :
    247 ATGAGCAGGATGTGGAGGTAGCCCTCGATCACCGTGCAGTTCTCCAGGCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 250625 ATGAGCAGGATGTGGAGGTAGCCCTCGATCACCGTGCAGTTCTCCAGGCG

    300     .    :    .    :    .    :    .    :    .    :
    297 CTTCAGCTGCTGATAGTCGTTGCGGATGTCGATGCCTGGCCGCGCAGAGT
        |||||||||||||||||||||||||||||||||||||||||-|||||| |
 250675 CTTCAGCTGCTGATAGTCGTTGCGGATGTCGATGCCTGGCC CGCAGACT

    350 
    347 TT
        --
 250724   

END