Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW951307.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW951307.1, 444 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|8140977|gb|AW951307.1|AW951307 EST363377 MAGE resequences, MAGA Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-402  (187881-188273)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 TTTCACAGGGGACAGGATGGTTCCCTTGATGAAGAAGTTGATATGCCTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187881 TTTCACAGGGGACAGGATGGTTCCCTTGATGAAGAAGTTGATATGCCTTT

     50     .    :    .    :    .    :    .    :    .    :
     51 TCCCAACTCCAGAAAGTGACAAGCTCACAGACCTTTGAACTAGAGTTTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187931 TCCCAACTCCAGAAAGTGACAAGCTCACAGACCTTTGAACTAGAGTTTAG

    100     .    :    .    :    .    :    .    :    .    :
    101 CTGGAAAAGTATGTTAGTGCAAATTGTCACAGGACAGCCCTTCTTTCCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187981 CTGGAAAAGTATGTTAGTGCAAATTGTCACAGGACAGCCCTTCTTTCCAC

    150     .    :    .    :    .    :    .    :    .    :
    151 AGAAGCTCCAGGTAGAGGGTGTGTAAGTAGATAGGCCATGGGCACTGTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188031 AGAAGCTCCAGGTAGAGGGTGTGTAAGTAGATAGGCCATGGGCACTGTGG

    200     .    :    .    :    .    :    .    :    .    :
    201 GTAGACACACATGAAGTCCAAGCATTTAGATGTATAGGTTGATGGTGGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188081 GTAGACACACATGAAGTCCAAGCATTTAGATGTATAGGTTGATGGTGGTA

    250     .    :    .    :    .    :    .    :    .    :
    251 TGTTTTCAGGCTAGATGTATGTACTTCATGCTGTCTACACTAAGAGAGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188131 TGTTTTCAGGCTAGATGTATGTACTTCATGCTGTCTACACTAAGAGAGAA

    300     .    :    .    :    .    :    .    :    .    :
    301 TGAGAGACACACTGAAGAAGCACCAATCATGAATTAGTTTTTATATGCTT
        |||||||||||||||||||||||||||||||||||||||||-||||||||
 188181 TGAGAGACACACTGAAGAAGCACCAATCATGAATTAGTTTT ATATGCTT

    350     .    :    .    :    .    :    .    :    .    :
    351 CTGTTTTAATAATTTTGGGGAAGCAAAAATTTTTTTTCTTCTTAGGGAAA
        ||||||||-|||||||| -|||||||||-||||||--|-||-||||-|||
 188230 CTGTTTTA TAATTTTGT GAAGCAAAA TTTTTT  C TC TAGG AAA

    400 
    401 TA
        ||
 188272 TA

END