Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW964452.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW964452.1, 555 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|8154288|gb|AW964452.1|AW964452 EST376525 MAGE resequences, MAGH Homo sapiens cDNA, mRNA sequence
>ENSG00000012048

(complement)

1-555  (80413-80968)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 ATACAGAAATTAGCCGGTCATGGTGGTGGACACCTGTAATCCCAGCTACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80413 ATACAGAAATTAGCCGGTCATGGTGGTGGACACCTGTAATCCCAGCTACT

     50     .    :    .    :    .    :    .    :    .    :
     51 CAGGTGGCTAAGGCAGGAGAATCACTTCAGCCCGGGAGGTGGAGGTTGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80463 CAGGTGGCTAAGGCAGGAGAATCACTTCAGCCCGGGAGGTGGAGGTTGCA

    100     .    :    .    :    .    :    .    :    .    :
    101 GTGAGCCAAGATCATACCACGGCACTCCAGCCTGGGTGACAGTGAGACTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80513 GTGAGCCAAGATCATACCACGGCACTCCAGCCTGGGTGACAGTGAGACTG

    150     .    :    .    :    .    :    .    :    .    :
    151 TGGCTCAAAAAAAAAAAAAAAAAAAGGAAAATGAAACTAGAAGAGATTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80563 TGGCTCAAAAAAAAAAAAAAAAAAAGGAAAATGAAACTAGAAGAGATTTC

    200     .    :    .    :    .    :    .    :    .    :
    201 TAAAAGTCTGAGATATATTTGCTAGATTTCTAAAGAATGTGTTCTAAAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80613 TAAAAGTCTGAGATATATTTGCTAGATTTCTAAAGAATGTGTTCTAAAAC

    250     .    :    .    :    .    :    .    :    .    :
    251 AGCAGAAGATTTTCAAGAACCGGTTTCCAAAGACAGTCTTCTAATTCCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80663 AGCAGAAGATTTTCAAGAACCGGTTTCCAAAGACAGTCTTCTAATTCCTC

    300     .    :    .    :    .    :    .    :    .    :
    301 ATTAGTAATAAGTAAAATGTTTATTGATGTAGCTCTGGTATATAATCCAT
        |||||||||||||||||||||||||| |||||||||||||||||||||||
  80713 ATTAGTAATAAGTAAAATGTTTATTGTTGTAGCTCTGGTATATAATCCAT

    350     .    :    .    :    .    :    .    :    .    :
    351 TCCTCTTAAAATATAAGACCTCTGGCATGAATATTCCATATCTATAAAAT
        ||||||||||||||||||||||||||||||||||| ||||||||||||||
  80763 TCCTCTTAAAATATAAGACCTCTGGCATGAATATTTCATATCTATAAAAT

    400     .    :    .    :    .    :    .    :    .    :
    401 GACAGATCCCACCAAGAAGGAAGCTGGTGCTTTCTTTGAGGTGATTTTTT
        |||||||||||||| ||||||||||| |||||||||||||||||||||||
  80813 GACAGATCCCACCAGGAAGGAAGCTGTTGCTTTCTTTGAGGTGATTTTTT

    450     .    :    .    :    .    :    .    :    .    :
    451 TCCTTGGCTCCCTGTTGCTGAAACC TTCAGTTTCATAAATAATTCCGCT
        ||||| |||||||||||||||||||-| ||| |||||||||||||  |||
  80863 TCCTTTGCTCCCTGTTGCTGAAACCATACAGCTTCATAAATAATTTTGCT

    500     .    :    .    :    .    :    .    :    .    :
    500 GGCTGAAGGAAGAAAAAGTGTTTTTCATAAACCCATTATCCAAGAATGTT
         ||||||||||||||||||||||||||||||||||||||||| || ||||
  80913 TGCTGAAGGAAGAAAAAGTGTTTTTCATAAACCCATTATCCAGGACTGTT

    550     .
    550 TATAAC
        |||| |
  80963 TATAGC

END