Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BC012419.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/BC012419.1, 1157 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|15214586|gb|BC012419.1| Homo sapiens CD40 antigen (TNF receptor superfamily member 5), transcript variant 1, mRNA (cDNA clone MGC:9013 IMAGE:3856903), complete cds
>ENSG00000101017

1-108  (21-128)   100% ->
109-187  (3554-3632)   100% ->
188-313  (3967-4092)   100% ->
314-460  (4344-4490)   100% ->
461-554  (4860-4953)   100% ->
555-616  (8374-8435)   100% ->
617-703  (9872-9958)   100% ->
704-732  (10064-10092)   100% ->
733-1142  (10616-11025)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GTCAGCAGAGGCCTCGCTCGGGCGCCCAGTGGTCCTGCCGCCTGGTCTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     21 GTCAGCAGAGGCCTCGCTCGGGCGCCCAGTGGTCCTGCCGCCTGGTCTCA

     50     .    :    .    :    .    :    .    :    .    :
     51 CCTCGCTATGGTTCGTCTGCCTCTGCAGTGCGTCCTCTGGGGCTGCTTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     71 CCTCGCTATGGTTCGTCTGCCTCTGCAGTGCGTCCTCTGGGGCTGCTTGC

    100     .    :    .    :    .    :    .    :    .    :
    101 TGACCGCT         GTCCATCCAGAACCACCCACTGCATGCAGAGAA
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
    121 TGACCGCTGTG...TAGGTCCATCCAGAACCACCCACTGCATGCAGAGAA

    150     .    :    .    :    .    :    .    :    .    :
    142 AAACAGTACCTAATAAACAGTCAGTGCTGTTCTTTGTGCCAGCCAG    
        ||||||||||||||||||||||||||||||||||||||||||||||>>>.
   3587 AAACAGTACCTAATAAACAGTCAGTGCTGTTCTTTGTGCCAGCCAGGTG.

    200     .    :    .    :    .    :    .    :    .    :
    188      GACAGAAACTGGTGAGTGACTGCACAGAGTTCACTGAAACGGAAT
        ..>>>|||||||||||||||||||||||||||||||||||||||||||||
   3637 ..CAGGACAGAAACTGGTGAGTGACTGCACAGAGTTCACTGAAACGGAAT

    250     .    :    .    :    .    :    .    :    .    :
    233 GCCTTCCTTGCGGTGAAAGCGAATTCCTAGACACCTGGAACAGAGAGACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4012 GCCTTCCTTGCGGTGAAAGCGAATTCCTAGACACCTGGAACAGAGAGACA

    300     .    :    .    :    .    :    .    :    .    :
    283 CACTGCCACCAGCACAAATACTGCGACCCCA         ACCTAGGGCT
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
   4062 CACTGCCACCAGCACAAATACTGCGACCCCAGTG...CAGACCTAGGGCT

    350     .    :    .    :    .    :    .    :    .    :
    324 TCGGGTCCAGCAGAAGGGCACCTCAGAAACAGACACCATCTGCACCTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4354 TCGGGTCCAGCAGAAGGGCACCTCAGAAACAGACACCATCTGCACCTGTG

    400     .    :    .    :    .    :    .    :    .    :
    374 AAGAAGGCTGGCACTGTACGAGTGAGGCCTGTGAGAGCTGTGTCCTGCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4404 AAGAAGGCTGGCACTGTACGAGTGAGGCCTGTGAGAGCTGTGTCCTGCAC

    450     .    :    .    :    .    :    .    :    .    :
    424 CGCTCATGCTCGCCCGGCTTTGGGGTCAAGCAGATTG         CTAC
        |||||||||||||||||||||||||||||||||||||>>>...>>>||||
   4454 CGCTCATGCTCGCCCGGCTTTGGGGTCAAGCAGATTGGTA...CAGCTAC

    500     .    :    .    :    .    :    .    :    .    :
    465 AGGGGTTTCTGATACCATCTGCGAGCCCTGCCCAGTCGGCTTCTTCTCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4864 AGGGGTTTCTGATACCATCTGCGAGCCCTGCCCAGTCGGCTTCTTCTCCA

    550     .    :    .    :    .    :    .    :    .    :
    515 ATGTGTCATCTGCTTTCGAAAAATGTCACCCTTGGACAAG         C
        ||||||||||||||||||||||||||||||||||||||||>>>...>>>|
   4914 ATGTGTCATCTGCTTTCGAAAAATGTCACCCTTGGACAAGGTA...TAGC

    600     .    :    .    :    .    :    .    :    .    :
    556 TGTGAGACCAAAGACCTGGTTGTGCAACAGGCAGGCACAAACAAGACTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   8375 TGTGAGACCAAAGACCTGGTTGTGCAACAGGCAGGCACAAACAAGACTGA

    650     .    :    .    :    .    :    .    :    .    :
    606 TGTTGTCTGTG         GTCCCCAGGATCGGCTGAGAGCCCTGGTGG
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
   8425 TGTTGTCTGTGGTG...CAGGTCCCCAGGATCGGCTGAGAGCCCTGGTGG

    700     .    :    .    :    .    :    .    :    .    :
    647 TGATCCCCATCATCTTCGGGATCCTGTTTGCCATCCTCTTGGTGCTGGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   9902 TGATCCCCATCATCTTCGGGATCCTGTTTGCCATCCTCTTGGTGCTGGTC

    750     .    :    .    :    .    :    .    :    .    :
    697 TTTATCA         AAAAGGTGGCCAAGAAGCCAACCAATAAG     
        |||||||>>>...>>>|||||||||||||||||||||||||||||>>>..
   9952 TTTATCAGTG...TAGAAAAGGTGGCCAAGAAGCCAACCAATAAGGTA..

    800     .    :    .    :    .    :    .    :    .    :
    733     GCCCCCCACCCCAAGCAGGAACCCCAGGAGATCAATTTTCCCGACG
        .>>>||||||||||||||||||||||||||||||||||||||||||||||
  10098 .CAGGCCCCCCACCCCAAGCAGGAACCCCAGGAGATCAATTTTCCCGACG

    850     .    :    .    :    .    :    .    :    .    :
    779 ATCTTCCTGGCTCCAACACTGCTGCTCCAGTGCAGGAGACTTTACATGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10662 ATCTTCCTGGCTCCAACACTGCTGCTCCAGTGCAGGAGACTTTACATGGA

    900     .    :    .    :    .    :    .    :    .    :
    829 TGCCAACCGGTCACCCAGGAGGATGGCAAAGAGAGTCGCATCTCAGTGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10712 TGCCAACCGGTCACCCAGGAGGATGGCAAAGAGAGTCGCATCTCAGTGCA

    950     .    :    .    :    .    :    .    :    .    :
    879 GGAGAGACAGTGAGGCTGCACCCACCCAGGAGTGTGGCCACGTGGGCAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10762 GGAGAGACAGTGAGGCTGCACCCACCCAGGAGTGTGGCCACGTGGGCAAA

   1000     .    :    .    :    .    :    .    :    .    :
    929 CAGGCAGTTGGCCAGAGAGCCTGGTGCTGCTGCTGCTGTGGCGTGAGGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10812 CAGGCAGTTGGCCAGAGAGCCTGGTGCTGCTGCTGCTGTGGCGTGAGGGT

   1050     .    :    .    :    .    :    .    :    .    :
    979 GAGGGGCTGGCACTGACTGGGCATAGCTCCCCGCTTCTGCCTGCACCCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10862 GAGGGGCTGGCACTGACTGGGCATAGCTCCCCGCTTCTGCCTGCACCCCT

   1100     .    :    .    :    .    :    .    :    .    :
   1029 GCAGTTTGAGACAGGAGACCTGGCACTGGATGCAGAAACAGTTCACCTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10912 GCAGTTTGAGACAGGAGACCTGGCACTGGATGCAGAAACAGTTCACCTTG

   1150     .    :    .    :    .    :    .    :    .    :
   1079 AAGAACCTCTCACTTCACCCTGGAGCCCATCCAGTCTCCCAACTTGTATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10962 AAGAACCTCTCACTTCACCCTGGAGCCCATCCAGTCTCCCAACTTGTATT

   1200     .    :
   1129 AAAGACAGAGGCAG
        ||||||||||||||
  11012 AAAGACAGAGGCAG

END