Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BE044197.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BE044197.1, 425 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|8361250|gb|BE044197.1|BE044197 ho40a11.x1 Soares_NFL_T_GBC_S1 Homo sapiens cDNA clone IMAGE:3039836 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

1-310  (3-312)   100% <-
311-425  (17255-17369)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 TTTCTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      3 TTTCTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCCA

     50     .    :    .    :    .    :    .    :    .    :
     51 GGACCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     53 GGACCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGT

    100     .    :    .    :    .    :    .    :    .    :
    101 TTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    103 TTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAA

    150     .    :    .    :    .    :    .    :    .    :
    151 ACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    153 ACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAG

    200     .    :    .    :    .    :    .    :    .    :
    201 CAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    203 CAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTC

    250     .    :    .    :    .    :    .    :    .    :
    251 CTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    253 CTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCA

    300     .    :    .    :    .    :    .    :    .    :
    301 AATGTACTTC         CTTCTGGGTCTTGGGCATGTCGGTGTGGCGC
        ||||||||||<<<...<<<|||||||||||||||||||||||||||||||
    303 AATGTACTTCCTA...TACCTTCTGGGTCTTGGGCATGTCGGTGTGGCGC

    350     .    :    .    :    .    :    .    :    .    :
    342 TGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17286 TGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAATA

    400     .    :    .    :    .    :
    392 CATCTCCAGCCTCCTTAGATCACAGCTCCGGAAG
        ||||||||||||||||||||||||||||||||||
  17336 CATCTCCAGCCTCCTTAGATCACAGCTCCGGAAG

END