Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BE206562.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BE206562.1, 488 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|8749960|gb|BE206562.1|BE206562 bb22c09.x1 NIH_MGC_14 Homo sapiens cDNA clone IMAGE:2963632 3' similar to contains Alu repetitive element;, mRNA sequence
>ENSG00000012048

1-488  (516-1003)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 TTTTTTTTGAGCCACAGTCTCACTGTCACCCAGGCTGGAGTGCCGTGGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    516 TTTTTTTTGAGCCACAGTCTCACTGTCACCCAGGCTGGAGTGCCGTGGTA

     50     .    :    .    :    .    :    .    :    .    :
     51 TGATCTTGGCTCACTGCAACCTCCACCTCCCGGGCTGAAGTGATTCTCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    566 TGATCTTGGCTCACTGCAACCTCCACCTCCCGGGCTGAAGTGATTCTCCT

    100     .    :    .    :    .    :    .    :    .    :
    101 GCCTTAGCCACCTGAGTAGCTGGGATTACAGGTGTCCACCACCATGACCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    616 GCCTTAGCCACCTGAGTAGCTGGGATTACAGGTGTCCACCACCATGACCG

    150     .    :    .    :    .    :    .    :    .    :
    151 GCTAATTTCTGTATTTTTAGTAGAGATGGGGTTTCACCATGTTGGCCAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    666 GCTAATTTCTGTATTTTTAGTAGAGATGGGGTTTCACCATGTTGGCCAGG

    200     .    :    .    :    .    :    .    :    .    :
    201 CTGGTTTCGAACTCCTGACCTCCAGTGATCTGCCCACCTTGGCCTCCCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    716 CTGGTTTCGAACTCCTGACCTCCAGTGATCTGCCCACCTTGGCCTCCCAA

    250     .    :    .    :    .    :    .    :    .    :
    251 AGTGCTGGGATTACAGGCGTGAGCCACCATGCCCAGGTTTCAAGTTTCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    766 AGTGCTGGGATTACAGGCGTGAGCCACCATGCCCAGGTTTCAAGTTTCCT

    300     .    :    .    :    .    :    .    :    .    :
    301 TTTCATTTCTAATACCTGCCTCAGAATTTCCTCCCCAATGTTCCACTCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    816 TTTCATTTCTAATACCTGCCTCAGAATTTCCTCCCCAATGTTCCACTCCA

    350     .    :    .    :    .    :    .    :    .    :
    351 ACATTTGAGAACTGCCCAAGGACTATTCTGACTTTAAGTCACATAATCGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    866 ACATTTGAGAACTGCCCAAGGACTATTCTGACTTTAAGTCACATAATCGA

    400     .    :    .    :    .    :    .    :    .    :
    401 TCCCAAGCACTCTCCTTCCATTGAAGGGTCTGACTCTCTGCATTTGTGAA
        ||||||||||||||||||||||||||||||||||||||||| ||||||||
    916 TCCCAAGCACTCTCCTTCCATTGAAGGGTCTGACTCTCTGCCTTTGTGAA

    450     .    :    .    :    .    :    .
    451 CACAGGGTTTTAGAGAAGTAAACTTAGGGAAACCAGCT
        ||||||||||||||||||||||||||||||||||||||
    966 CACAGGGTTTTAGAGAAGTAAACTTAGGGAAACCAGCT

END