Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BE672442.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BE672442.1, 689 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|10032983|gb|BE672442.1|BE672442 7a60h04.x1 NCI_CGAP_GC6 Homo sapiens cDNA clone IMAGE:3223159 3' similar to gb:M28668 CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR (HUMAN);, mRNA sequence
>ENSG00000001626

(complement)

1-395  (40746-41140)   98% <-
396-496  (53949-54049)   100% <-
497-689  (56854-57045)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 TTTTTTTAATAAAACATGTGTGTTTAATATTGATTCTACTGTACAATAAT
        |   | ||||||||||||||||||||||||||||||||||||||||||||
  40746 TCCATATAATAAAACATGTGTGTTTAATATTGATTCTACTGTACAATAAT

     50     .    :    .    :    .    :    .    :    .    :
     51 AATGTTACAAATAGATTCTGCTAACACATTGCTTCAGGCTACTGGGATTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  40796 AATGTTACAAATAGATTCTGCTAACACATTGCTTCAGGCTACTGGGATTC

    100     .    :    .    :    .    :    .    :    .    :
    101 ACTTACTGAACACAGTCTAACAAAGCAAGCAGTGTTCAAATCTCACCCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  40846 ACTTACTGAACACAGTCTAACAAAGCAAGCAGTGTTCAAATCTCACCCTC

    150     .    :    .    :    .    :    .    :    .    :
    151 TGGCCAGGACTTATTGAGAAGGAAATGTTCTCTAATATGGCATTTCCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  40896 TGGCCAGGACTTATTGAGAAGGAAATGTTCTCTAATATGGCATTTCCACC

    200     .    :    .    :    .    :    .    :    .    :
    201 TTCTGTGTATTTTGCTGTGAGATCTTTGACAGTCATTTGGCCCCCTGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  40946 TTCTGTGTATTTTGCTGTGAGATCTTTGACAGTCATTTGGCCCCCTGAGG

    250     .    :    .    :    .    :    .    :    .    :
    251 GCCAGATGTCATCTTTCTTCACTTGTGAATTCTCAATAATCATAACTTTC
        |||||||||||||||||||||| |||||||||||||||||||||||||||
  40996 GCCAGATGTCATCTTTCTTCACGTGTGAATTCTCAATAATCATAACTTTC

    300     .    :    .    :    .    :    .    :    .    :
    301 GAGAGTTGGCCATTCTTGTATGGTTTGGTTGACTTGGTAGGTTTACCTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  41046 GAGAGTTGGCCATTCTTGTATGGTTTGGTTGACTTGGTAGGTTTACCTTC

    350     .    :    .    :    .    :    .    :    .    :
    351 TGTTGGCATGTCAATGAACTTAAAGACTCGGCTCACAGATCGCAT     
        |||||||||||||||||||||||||||||||||||||||||||||<<<..
  41096 TGTTGGCATGTCAATGAACTTAAAGACTCGGCTCACAGATCGCATCTG..

    400     .    :    .    :    .    :    .    :    .    :
    396     CAAGCTATCCACATCTATGCTGGAGTTTACAGCCCACTGCAATGTA
        .<<<||||||||||||||||||||||||||||||||||||||||||||||
  41146 .TACCAAGCTATCCACATCTATGCTGGAGTTTACAGCCCACTGCAATGTA

    450     .    :    .    :    .    :    .    :    .    :
    442 CTCATGATATTCATGGCTAAAGTCAGGATAATACCAACTCTTCCTTCTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  53995 CTCATGATATTCATGGCTAAAGTCAGGATAATACCAACTCTTCCTTCTCC

    500     .    :    .    :    .    :    .    :    .    :
    492 TTCTC         CTGTTGTTAAAATGGAAATGAAGGTAACAGCAATGA
        |||||<<<...<<<||||||||||||||||||||||||||||||||||||
  54045 TTCTCCTA...TACCTGTTGTTAAAATGGAAATGAAGGTAACAGCAATGA

    550     .    :    .    :    .    :    .    :    .    :
    533 AGAAGATGACAAAAATCATTTCTATTCTCATTTGGAACCAGCGCAGTGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  56890 AGAAGATGACAAAAATCATTTCTATTCTCATTTGGAACCAGCGCAGTGTT

    600     .    :    .    :    .    :    .    :    .    :
    583 GACAGGTACAAGAAACCAGT GGCAGTATGTAAATTCAGAGCTTTGTGGA
        ||||||||||||||-|||||-|||||||||||||||||||||||||||||
  56940 GACAGGTACAAGAA CCAGTTGGCAGTATGTAAATTCAGAGCTTTGTGGA

    650     .    :    .    :    .    :    .    :    .    :
    632 ACAGAGTTTCAAAGTTAGGCTGCCGTCCGAAGGCACGAAGTGTCCATAGT
        ||||||||||||||| ||||||||||||||||||||||||||||||||||
  56989 ACAGAGTTTCAAAGTAAGGCTGCCGTCCGAAGGCACGAAGTGTCCATAGT

    700     .
    682 CCCTTTTA
        ||-|||||
  57039 CC TTTTA

END