Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BE695869.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BE695869.1, 578 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|10083029|gb|BE695869.1|BE695869 RC1-CT0249-090800-029-c04 CT0249 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

(complement)

1-578  (756-1332)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 TTCTGGAGATGGGAAAAGGCATATCAACTTCTTCATCAAGGGAACCATCC
        |||||||| |||||||||||||||||||||||||||||||||||||||||
    756 TTCTGGAGTTGGGAAAAGGCATATCAACTTCTTCATCAAGGGAACCATCC

     50     .    :    .    :    .    :    .    :    .    :
     51 TGTCCCCTGNTGAAAGATTATAACAGCCCTTTCCCAGGTAAGGGATGTAT
        |||||||||-||||||||||||||||||||||||||||||||||||||||
    806 TGTCCCCTG TGAAAGATTATAACAGCCCTTTCCCAGGTAAGGGATGTAT

    100     .    :    .    :    .    :    .    :    .    :
    101 TGTGATTATCTGAAATATTGAGATTTTTGGTAGACCTGGACAATACTAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    855 TGTGATTATCTGAAATATTGAGATTTTTGGTAGACCTGGACAATACTAAC

    150     .    :    .    :    .    :    .    :    .    :
    151 CCTGATTTCCAGGATCTGGAAGTTCTCTTTCCTGACTGCTCACTAGATGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    905 CCTGATTTCCAGGATCTGGAAGTTCTCTTTCCTGACTGCTCACTAGATGT

    200     .    :    .    :    .    :    .    :    .    :
    201 TGAATGGGGCATATTTTGATGTGCAGTCTTGTGGTTCCTGTGGTATTCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    955 TGAATGGGGCATATTTTGATGTGCAGTCTTGTGGTTCCTGTGGTATTCTA

    250     .    :    .    :    .    :    .    :    .    :
    251 ATACTTGCTTGGAAATGAGATAGTTGGAATGCTTAGCGAACGATATAGTT
        ||||||||||||||||||||||||||||||||||||| ||| ||||||||
   1005 ATACTTGCTTGGAAATGAGATAGTTGGAATGCTTAGCAAACAATATAGTT

    300     .    :    .    :    .    :    .    :    .    :
    301 GTGTTTCTAAACATCATGGGGAGAGGAGAGAAAAAGGAATACAAGCTTAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1055 GTGTTTCTAAACATCATGGGGAGAGGAGAGAAAAAGGAATACAAGCTTAT

    350     .    :    .    :    .    :    .    :    .    :
    351 ATAAACCGCTGAAGTTTCCAGTTATCATTACTTAATCATAACCCTAAGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1105 ATAAACCGCTGAAGTTTCCAGTTATCATTACTTAATCATAACCCTAAGAA

    400     .    :    .    :    .    :    .    :    .    :
    401 GTATGATTTCAGTTCTTCTCCAACACTACAAATTAACGAGTTTCACTAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1155 GTATGATTTCAGTTCTTCTCCAACACTACAAATTAACGAGTTTCACTAGA

    450     .    :    .    :    .    :    .    :    .    :
    451 CAATAAGCTGATCAACTAGGCTGATTGACATTTAGGGCTGCCTTTCCAAT
        ||||||||||||||||||||||||||||||||||| ||||||||||||||
   1205 CAATAAGCTGATCAACTAGGCTGATTGACATTTAGAGCTGCCTTTCCAAT

    500     .    :    .    :    .    :    .    :    .    :
    501 TACTAGCACATGGCAAGGGTTTTCAGGAAAATCTGGCTTGCAAAGCACAA
        |||||||||||||||||||||||||||||||||||||||||||| |||||
   1255 TACTAGCACATGGCAAGGGTTTTCAGGAAAATCTGGCTTGCAAAACACAA

    550     .    :    .    :    .
    551 GTGGTAAATCTTCAAGGATTTGAAGTAC
        ||||||||||||||||||||||||||||
   1305 GTGGTAAATCTTCAAGGATTTGAAGTAC

END