Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BE908916.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BE908916.1, 595 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|10403973|gb|BE908916.1|BE908916 601497850F1 NIH_MGC_70 Homo sapiens cDNA clone IMAGE:3899844 5', mRNA sequence
>ENSG00000101017

1-123  (6-128)   98% ->
124-202  (3554-3632)   100% ->
203-328  (3967-4092)   100% ->
329-475  (4344-4490)   100% ->
476-569  (4860-4953)   100% ->
570-595  (8374-8399)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGCTGGGGCAGGGGAGTCAGGCAGAGGCCTCGCTCGGGCGCCCAGTGGTC
        |||||||||||||||||||-||||||||||||||||||||||||||||||
      6 GGCTGGGGCAGGGGAGTCA GCAGAGGCCTCGCTCGGGCGCCCAGTGGTC

     50     .    :    .    :    .    :    .    :    .    :
     51 CTGCCGCCTGGTCTCACCTCGCTATGGTTCGTCTGCCTCTGCAGTGCGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     55 CTGCCGCCTGGTCTCACCTCGCTATGGTTCGTCTGCCTCTGCAGTGCGTC

    100     .    :    .    :    .    :    .    :    .    :
    101  TCTGGGGCTGCTTGCTGACCGCT         GTCCATCCAGAACCACC
        -|||||||||||||||||||||||>>>...>>>|||||||||||||||||
    105 CTCTGGGGCTGCTTGCTGACCGCTGTG...TAGGTCCATCCAGAACCACC

    150     .    :    .    :    .    :    .    :    .    :
    141 CACTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGTTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3571 CACTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGTTCTT

    200     .    :    .    :    .    :    .    :    .    :
    191 TGTGCCAGCCAG         GACAGAAACTGGTGAGTGACTGCACAGAG
        ||||||||||||>>>...>>>|||||||||||||||||||||||||||||
   3621 TGTGCCAGCCAGGTG...CAGGACAGAAACTGGTGAGTGACTGCACAGAG

    250     .    :    .    :    .    :    .    :    .    :
    232 TTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAGACAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3996 TTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAGACAC

    300     .    :    .    :    .    :    .    :    .    :
    282 CTGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCCCA   
        |||||||||||||||||||||||||||||||||||||||||||||||>>>
   4046 CTGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCCCAGTG

    350     .    :    .    :    .    :    .    :    .    :
    329       ACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAACAGAC
        ...>>>||||||||||||||||||||||||||||||||||||||||||||
   4096 ...CAGACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAACAGAC

    400     .    :    .    :    .    :    .    :    .    :
    373 ACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCTGTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4388 ACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCTGTGA

    450     .    :    .    :    .    :    .    :    .    :
    423 GAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAGCAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4438 GAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAGCAGA

    500     .    :    .    :    .    :    .    :    .    :
    473 TTG         CTACAGGGGTTTCTGATACCATCTGCGAGCCCTGCCCA
        |||>>>...>>>||||||||||||||||||||||||||||||||||||||
   4488 TTGGTA...CAGCTACAGGGGTTTCTGATACCATCTGCGAGCCCTGCCCA

    550     .    :    .    :    .    :    .    :    .    :
    514 GTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCACCCTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4898 GTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCACCCTTG

    600     .    :    .    :    .    :    .    :
    564 GACAAG         CTGTGAGACCAAAGACCTGGTTGTGC
        ||||||>>>...>>>||||||||||||||||||||||||||
   4948 GACAAGGTA...TAGCTGTGAGACCAAAGACCTGGTTGTGC

END