Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF032564.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF032564.1, 727 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|10740276|gb|BF032564.1|BF032564 601453227F1 NIH_MGC_66 Homo sapiens cDNA clone IMAGE:3856903 5', mRNA sequence
>ENSG00000101017

1-87  (42-128)   100% ->
88-167  (3554-3632)   98% ->
168-293  (3967-4092)   100% ->
294-440  (4344-4490)   100% ->
441-534  (4860-4953)   100% ->
535-596  (8374-8435)   100% ->
597-676  (9872-9953)   95%

      0     .    :    .    :    .    :    .    :    .    :
      1 GCGCCCAGTGGTCCTGCCGCCTGGTCTCACCTCGCTATGGTTCGTCTGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     42 GCGCCCAGTGGTCCTGCCGCCTGGTCTCACCTCGCTATGGTTCGTCTGCC

     50     .    :    .    :    .    :    .    :    .    :
     51 TCTGCAGTGCGTCCTCTGGGGCTGCTTGCTGACCGCT         GTCC
        |||||||||||||||||||||||||||||||||||||>>>...>>>||||
     92 TCTGCAGTGCGTCCTCTGGGGCTGCTTGCTGACCGCTGTG...TAGGTCC

    100     .    :    .    :    .    :    .    :    .    :
     92 ATCCAGAACCACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3558 ATCCAGAACCACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAGT

    150     .    :    .    :    .    :    .    :    .    :
    142 CAGTGCTGTTCTTTGTGCCAGCCTAG         GACAGAAACTGGTGA
        |||||||||||||||||||||||-||>>>...>>>|||||||||||||||
   3608 CAGTGCTGTTCTTTGTGCCAGCC AGGTG...CAGGACAGAAACTGGTGA

    200     .    :    .    :    .    :    .    :    .    :
    183 GTGACTGCACAGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3982 GTGACTGCACAGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGC

    250     .    :    .    :    .    :    .    :    .    :
    233 GAATTCCTAGACACCTGGAACAGAGAGACACACTGCCACCAGCACAAATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4032 GAATTCCTAGACACCTGGAACAGAGAGACACACTGCCACCAGCACAAATA

    300     .    :    .    :    .    :    .    :    .    :
    283 CTGCGACCCCA         ACCTAGGGCTTCGGGTCCAGCAGAAGGGCA
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
   4082 CTGCGACCCCAGTG...CAGACCTAGGGCTTCGGGTCCAGCAGAAGGGCA

    350     .    :    .    :    .    :    .    :    .    :
    324 CCTCAGAAACAGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4374 CCTCAGAAACAGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACG

    400     .    :    .    :    .    :    .    :    .    :
    374 AGTGAGGCCTGTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4424 AGTGAGGCCTGTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTT

    450     .    :    .    :    .    :    .    :    .    :
    424 TGGGGTCAAGCAGATTG         CTACAGGGGTTTCTGATACCATCT
        |||||||||||||||||>>>...>>>||||||||||||||||||||||||
   4474 TGGGGTCAAGCAGATTGGTA...CAGCTACAGGGGTTTCTGATACCATCT

    500     .    :    .    :    .    :    .    :    .    :
    465 GCGAGCCCTGCCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4884 GCGAGCCCTGCCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAA

    550     .    :    .    :    .    :    .    :    .    :
    515 AAATGTCACCCTTGGACAAG         CTGTGAGACCAAAGACCTGGT
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
   4934 AAATGTCACCCTTGGACAAGGTA...TAGCTGTGAGACCAAAGACCTGGT

    600     .    :    .    :    .    :    .    :    .    :
    556 TGTGCAACAGGCAGGCACAAACAAGACTGATGTTGTCTGTG         
        |||||||||||||||||||||||||||||||||||||||||>>>...>>>
   8395 TGTGCAACAGGCAGGCACAAACAAGACTGATGTTGTCTGTGGTG...CAG

    650     .    :    .    :    .    :    .    :    .    :
    597 GTCCCCAGGATCGGCTGAGAGCCCTGGTGGTGATCCCCATCATCTTCGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   9872 GTCCCCAGGATCGGCTGAGAGCCCTGGTGGTGATCCCCATCATCTTCGGG

    700     .    :    .    :    .    :
    647 GATCCTGTTTGC ATC TCT GGTGCTGGTCTT
        -|||||||||||-|||-|||-||||||||||||
   9922  ATCCTGTTTGCCATCCTCTTGGTGCTGGTCTT

END