Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF061073.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF061073.1, 505 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|10819983|gb|BF061073.1|BF061073 7i80c03.x1 NCI_CGAP_Ov18 Homo sapiens cDNA clone IMAGE:3340996 3' similar to SW:IG1R_MOUSE Q60751 INSULIN-LIKE GROWTH FACTOR I RECEPTOR PRECURSOR ;, mRNA sequence
>ENSG00000140443

13-342  (1-329)   99% ->
343-505  (1188-1349)   99%

      0     .    :    .    :    .    :    .    :    .    :
     13 GAGAAAGGGGAATTTCATCCCAAATAAAAGGAATGAAGTCTGGCTCCGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 GAGAAAGGGGAATTTCATCCCAAATAAAAGGAATGAAGTCTGGCTCCGGA

     50     .    :    .    :    .    :    .    :    .    :
     63 GGAGGGTCCCCGACCTCGCTGTGGGGGCTCCTGTTTCTCTCCGCCGCGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 GGAGGGTCCCCGACCTCGCTGTGGGGGCTCCTGTTTCTCTCCGCCGCGCT

    100     .    :    .    :    .    :    .    :    .    :
    113 CTCGCTCTGGCCGACGAGTGGAGAAAGTGAGTATGTGCCCGCCGCCCGCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 CTCGCTCTGGCCGACGAGTGGAGAAAGTGAGTATGTGCCCGCCGCCCGCG

    150     .    :    .    :    .    :    .    :    .    :
    163 GCCACTGCGGGAACTTTTCCTCCGAGGGGCTGCGCCCTGTTTGCGAAACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 GCCACTGCGGGAACTTTTCCTCCGAGGGGCTGCGCCCTGTTTGCGAAACC

    200     .    :    .    :    .    :    .    :    .    :
    213 CGAGTTGCCACCGTCGCAGCTGTCGGGCCCCCGGGCTCGGGAGCGGCGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 CGAGTTGCCACCGTCGCAGCTGTCGGGCCCCCGGGCTCGGGAGCGGCGGG

    250     .    :    .    :    .    :    .    :    .    :
    263 GTGGGGCGCAGGGCGGCTCTGCCGGGAGGGAGGCTGCAGCGGACCCGGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    251 GTGGGGCGCAGGGCGGCTCTGCCGGGAGGGAGGCTGCAGCGGACCCGGGA

    300     .    :    .    :    .    :    .    :    .    :
    313 CCCGGGCTCGTTCGTCTGGAGCCCCGCGAG         CCCTGGCCTTG
        ||||||||||||||||||||||||||||-|>>>...>>>|||||||||||
    301 CCCGGGCTCGTTCGTCTGGAGCCCCGCG GGCC...GAGCCCTGGCCTTG

    350     .    :    .    :    .    :    .    :    .    :
    354 GTTTTGTTGTGGTCGGCGTCGTGTCGCCCTCTCTTCTGCCGCCCCGCACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1199 GTTTTGTTGTGGTCGGCGTCGTGTCGCCCTCTCTTCTGCCGCCCCGCACT

    400     .    :    .    :    .    :    .    :    .    :
    404 TCCTTTGTACGTAGTTAATAAGCAGTGTCGCTCCACATTCGCTGTCTTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1249 TCCTTTGTACGTAGTTAATAAGCAGTGTCGCTCCACATTCGCTGTCTTTT

    450     .    :    .    :    .    :    .    :    .    :
    454 GCAATCTGATAGCTTTTGTTTTGGTGGTGTCGGGTGGGGGTTAGTAAGGG
        ||||||||||||||||||||||||||||||||||||||||||||||-|||
   1299 GCAATCTGATAGCTTTTGTTTTGGTGGTGTCGGGTGGGGGTTAGTA GGG

    500 
    504 AA
        ||
   1348 AA

END