Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF109498.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF109498.1, 328 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|10939188|gb|BF109498.1|BF109498 7l63f02.x1 Soares_NSF_F8_9W_OT_PA_P_S1 Homo sapiens cDNA clone IMAGE:3526035 3', mRNA sequence
>ENSG00000017427

225-248  (51045-51068)   83% ==
309-328  (53969-53988)   100%

      0     .    :    .    :
    225 GCTTTTTGTTTGTTTGTTTGTTTT
        ||||    ||||||||||||||||
  51045 GCTTGGCATTTGTTTGTTTGTTTT

      0     .    :    .    :
    309 TGTGTGTGTGTGTGTGTGTG
        ||||||||||||||||||||
  53969 TGTGTGTGTGTGTGTGTGTG

END