Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF111331.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF111331.1, 335 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|10941021|gb|BF111331.1|BF111331 7l75f04.x1 Soares_NSF_F8_9W_OT_PA_P_S1 Homo sapiens cDNA clone IMAGE:3527191 3' similar to contains element MER22 repetitive element ;, mRNA sequence
>ENSG00000017427

225-248  (51045-51068)   83% ==
309-335  (53969-53995)   100%

      0     .    :    .    :
    225 GCTTTTTGTTTGTTTGTTTGTTTT
        ||||    ||||||||||||||||
  51045 GCTTGGCATTTGTTTGTTTGTTTT

      0     .    :    .    :    .
    309 TGTGTGTGTGTGTGTGTGTGTGTGTGT
        |||||||||||||||||||||||||||
  53969 TGTGTGTGTGTGTGTGTGTGTGTGTGT

END