Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF115995.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF115995.1, 689 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|10985471|gb|BF115995.1|BF115995 7n76a11.x1 NCI_CGAP_Ov18 Homo sapiens cDNA clone IMAGE:3570356 3' similar to SW:IG1R_HUMAN P08069 INSULIN-LIKE GROWTH FACTOR I RECEPTOR PRECURSOR ;, mRNA sequence
>ENSG00000140443

1-117  (10-126)   100% ->
118-666  (58013-58560)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 GAATTTCATCCCAAATAAAAGGAATGAAGTCTGGCTCCGGAGGAGGGTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     10 GAATTTCATCCCAAATAAAAGGAATGAAGTCTGGCTCCGGAGGAGGGTCC

     50     .    :    .    :    .    :    .    :    .    :
     51 CCGACCTCGCTGTGGGGGCTCCTGTTTCTCTCCGCCGCGCTCTCGCTCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     60 CCGACCTCGCTGTGGGGGCTCCTGTTTCTCTCCGCCGCGCTCTCGCTCTG

    100     .    :    .    :    .    :    .    :    .    :
    101 GCCGACGAGTGGAGAAA         TCTGCGGGCCAGGCATCGACATCC
        |||||||||||||||||>>>...>>>||||||||||||||||||||||||
    110 GCCGACGAGTGGAGAAAGTG...CAGTCTGCGGGCCAGGCATCGACATCC

    150     .    :    .    :    .    :    .    :    .    :
    142 GCAACGACTATCAGCAGCTGAAGCGCCTGGAGAACTGCACGGTGATCGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58037 GCAACGACTATCAGCAGCTGAAGCGCCTGGAGAACTGCACGGTGATCGAG

    200     .    :    .    :    .    :    .    :    .    :
    192 GGCTACCTCCACATCCTGCTCATCTCCAAGGCCGAGGACTACCGCAGCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58087 GGCTACCTCCACATCCTGCTCATCTCCAAGGCCGAGGACTACCGCAGCTA

    250     .    :    .    :    .    :    .    :    .    :
    242 CCGCTTCCCCAAGCTCACGGTCATTACCGAGTACTTGCTGCTGTTCCGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58137 CCGCTTCCCCAAGCTCACGGTCATTACCGAGTACTTGCTGCTGTTCCGAG

    300     .    :    .    :    .    :    .    :    .    :
    292 TGGCTGGCCTCGAGAGCCTCGGAGACCTCTTCCCCAACCTCACGGTCATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58187 TGGCTGGCCTCGAGAGCCTCGGAGACCTCTTCCCCAACCTCACGGTCATC

    350     .    :    .    :    .    :    .    :    .    :
    342 CGCGGCTGGAAACTCTTCTACAACTACGCCCTGGTCATCTTCGAGATGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58237 CGCGGCTGGAAACTCTTCTACAACTACGCCCTGGTCATCTTCGAGATGAC

    400     .    :    .    :    .    :    .    :    .    :
    392 CAATCTCAAGGATATTGGGCTTTACAACCTGAGGAACATTAATCGGGGGG
        ||||||||||||||||||||||||||||||||||||||||| ||||||||
  58287 CAATCTCAAGGATATTGGGCTTTACAACCTGAGGAACATTACTCGGGGGG

    450     .    :    .    :    .    :    .    :    .    :
    442 CCATCAGGATTGAGAAAAATGCTGACCTCTGTTACCTCTCCACTGTGGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58337 CCATCAGGATTGAGAAAAATGCTGACCTCTGTTACCTCTCCACTGTGGAC

    500     .    :    .    :    .    :    .    :    .    :
    492 TGGTCCCTGATCCTGGATGCGGTGTCCAATAACTACATTGTGGGGAATAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58387 TGGTCCCTGATCCTGGATGCGGTGTCCAATAACTACATTGTGGGGAATAA

    550     .    :    .    :    .    :    .    :    .    :
    542 GCCCCCAAAAGAATGTGGGGACCTGTGTCCAGGGACCATGGATGAGAAGC
        ||||||||| |||||||||||||||||||||||||||||||| |||||||
  58437 GCCCCCAAAGGAATGTGGGGACCTGTGTCCAGGGACCATGGAGGAGAAGC

    600     .    :    .    :    .    :    .    :    .    :
    592 CGATGTGTGAGAAGACCACCATCAACAATGAGTACAACTACCGCTGCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58487 CGATGTGTGAGAAGACCACCATCAACAATGAGTACAACTACCGCTGCTGG

    650     .    :    .    :    .
    642 ACCACANACCGCTGCCAGAANATGT
        |||||| ||||||||||||| |-||
  58537 ACCACAAACCGCTGCCAGAAAA GT

END