Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF348967.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF348967.1, 247 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|11308041|gb|BF348967.1|BF348967 PM4-DT0061-010200-003-c12 DT0061 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-247  (187186-187432)   96%

      0     .    :    .    :    .    :    .    :    .    :
      1 AATTGGAGCTTTTGGGACAGTCACCTCATGGAATTGGAGCTC AGAGAAC
        ||||||||||  ||||||||||||||||||||||||||||||- |-||||
 187186 AATTGGAGCTCGTGGGACAGTCACCTCATGGAATTGGAGCTCGTG GAAC

     50     .    :    .    :    .    :    .    :    .    :
     50 AGTTACCTCTGCCTCACAAAACAAGGATGAATTAAGTTTTTTTTTAAAAA
        |||||||||||||||| |||||||||||||||||||||||||||||||||
 187235 AGTTACCTCTGCCTCAGAAAACAAGGATGAATTAAGTTTTTTTTTAAAAA

    100     .    :    .    :    .    :    .    :    .    :
    100 AGAAACATTTGGTAAGGGGAATTGAGGACACTGATATGGGTCTTGATAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187285 AGAAACATTTGGTAAGGGGAATTGAGGACACTGATATGGGTCTTGATAAA

    150     .    :    .    :    .    :    .    :    .    :
    150 TGGCTTCCTGGCAATATTCAAATTGTGTGAAAGGTACTTCAAATCCTTGA
        |||||||||||||||| |||||||||||||||||||||||||||||||||
 187335 TGGCTTCCTGGCAATAGTCAAATTGTGTGAAAGGTACTTCAAATCCTTGA

    200     .    :    .    :    .    :    .    :    .
    200 AGATTTACCACTTGTGTTTTGCAAGCCAGATTTTCCTGATAACCCTTG
        ||||||||||||||||||||||||||||||||||||||| ||||||||
 187385 AGATTTACCACTTGTGTTTTGCAAGCCAGATTTTCCTGAAAACCCTTG

END