Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF447679.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF447679.1, 500 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|11512817|gb|BF447679.1|BF447679 7q94a11.x1 NCI_CGAP_Lu24 Homo sapiens cDNA clone IMAGE:3705885 3', mRNA sequence
>ENSG00000012048

(complement)

11-500  (80541-81029)   98%

      0     .    :    .    :    .    :    .    :    .    :
     11 AGCCTGGGTGACAGTGAGACTGTGGCTCA GAAAAAAAAAAAAAAAAGGA
        |||||||||||||||||||||||||||||- |||||||||||||||||||
  80541 AGCCTGGGTGACAGTGAGACTGTGGCTCAAAAAAAAAAAAAAAAAAAGGA

     50     .    :    .    :    .    :    .    :    .    :
     60 AAATGAAACTAGAAGAGATTTCTAAAAGTCTGAGATATATTGGCTAGATT
        ||||||||||||||||||||||||||||||||||||||||| ||||||||
  80591 AAATGAAACTAGAAGAGATTTCTAAAAGTCTGAGATATATTTGCTAGATT

    100     .    :    .    :    .    :    .    :    .    :
    110 TCTAAAGAATGTGTTCTAAAACAGCAGAAGATTTTGCAAGAACCGGTTTC
        |||||||||||||||||||||||||||||||||||-||||||||||||||
  80641 TCTAAAGAATGTGTTCTAAAACAGCAGAAGATTTT CAAGAACCGGTTTC

    150     .    :    .    :    .    :    .    :    .    :
    160 CAAAGACAGTCTTCTAATTCCTCATTGGTAATAAGTAAAATGTTTATTGT
        |||||||||||||||||||||||||| |||||||||||||||||||||||
  80690 CAAAGACAGTCTTCTAATTCCTCATTAGTAATAAGTAAAATGTTTATTGT

    200     .    :    .    :    .    :    .    :    .    :
    210 TGTAGCTCTGGTATATAATCCATTCCCCTTTAAAATATAAGACCTCTGGC
        |||||||||||||||||||||||||| |-|||||||||||||||||||||
  80740 TGTAGCTCTGGTATATAATCCATTCCTC TTAAAATATAAGACCTCTGGC

    250     .    :    .    :    .    :    .    :    .    :
    260 ATGAATATTTCATATCTATAAAATGACAGATCCCACCAGGAAGGAAGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80789 ATGAATATTTCATATCTATAAAATGACAGATCCCACCAGGAAGGAAGCTG

    300     .    :    .    :    .    :    .    :    .    :
    310 TTGCTTTCTTTGAGGTGATTTTTTTCCTTTGCTCCCTGTTGCTGAAACCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80839 TTGCTTTCTTTGAGGTGATTTTTTTCCTTTGCTCCCTGTTGCTGAAACCA

    350     .    :    .    :    .    :    .    :    .    :
    360 TACAGCTTCATAAATAATTTTGCTTGCTGGAGGAAGAAAAAGTGTGTTTC
        ||||||||||||||||||||||||||||| ||||||||||||||| ||||
  80889 TACAGCTTCATAAATAATTTTGCTTGCTGAAGGAAGAAAAAGTGTTTTTC

    400     .    :    .    :    .    :    .    :    .    :
    410 ATAAACCCATTATCCAGGACTGTTTATAGCTGTTGGAAGGACTAGGTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80939 ATAAACCCATTATCCAGGACTGTTTATAGCTGTTGGAAGGACTAGGTCTT

    450     .    :    .    :    .    :    .    :
    460 CCCTAGCCCCCCCAGTGTGCAAGGGCAGTGAAGACTTGATT
        |||||||||||||||||||||||||||||||||||||||||
  80989 CCCTAGCCCCCCCAGTGTGCAAGGGCAGTGAAGACTTGATT

END