Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF764341.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF764341.1, 443 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|12112241|gb|BF764341.1|BF764341 CM3-CS0005-311000-443-b03 CS0005 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-443  (187454-187898)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGCAGCTCT AATGTC ATCAGCCTAGTTGATCAGCTTATTGTCTAGTGA
        |||||||||-||||||-|||||||||||||||||||||||||||||||||
 187454 GGCAGCTCTAAATGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGA

     50     .    :    .    :    .    :    .    :    .    :
     49 AACTCGTTAATTTGTAGTGTTGTAGAAGAACTGAAATCATACTTCTTAGG
        |||||||||||||||||||||| |||||||||||||||||||||||||||
 187504 AACTCGTTAATTTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGG

    100     .    :    .    :    .    :    .    :    .    :
     99 GTTATGATTAAGTAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187554 GTTATGATTAAGTAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTT

    150     .    :    .    :    .    :    .    :    .    :
    149 GTATTCCTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187604 GTATTCCTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATAT

    200     .    :    .    :    .    :    .    :    .    :
    199 TGTTTGCTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187654 TGTTTGCTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATAC

    250     .    :    .    :    .    :    .    :    .    :
    249 CACAGGAACCACAAGACTGCACATCAAAATATGCCCCATTCAACATCTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187704 CACAGGAACCACAAGACTGCACATCAAAATATGCCCCATTCAACATCTAG

    300     .    :    .    :    .    :    .    :    .    :
    299 TGAGCAGTCAGGAAAGAGAACTTCCAGATCCTGGAAATCAGGGTTAGTAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187754 TGAGCAGTCAGGAAAGAGAACTTCCAGATCCTGGAAATCAGGGTTAGTAT

    350     .    :    .    :    .    :    .    :    .    :
    349 TGTCCAGGTCTACCAAAAATCTCAATATTTCAGATAATCACAATACATCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187804 TGTCCAGGTCTACCAAAAATCTCAATATTTCAGATAATCACAATACATCC

    400     .    :    .    :    .    :    .    :    .
    399 CTTACCTGGGAAAGGGCTGTTATAATCTTTCACAGGGGACAGGAT
        |||||||||||||||||||||||||||||||||||||||||||||
 187854 CTTACCTGGGAAAGGGCTGTTATAATCTTTCACAGGGGACAGGAT

END